The "factory" itself, made of two [Choose] subunits [Choose] FRNA The site from which the growing polypeptide chain exits the ribosome RELEASE FACTOR CODON RIBOSOME P SITE The processed copy of DNA that carries its sequence of codons to the UGA TRNA ribosome AUG

Q: DNA MANNMANN B mRNA Transcription Transport to cytoplasm for protein synthesis (translation) Mature…

A: Introduction :- Protein synthesis is the process of creating proteins from amino acids inside live…

Q: For each, choose either replication, transcription, or translation. Okazaki fragment [ [ Choose ]…

A: The three main processes of central dogma of molecular biology are replication, transcription, and…

Q: Which of the following is a feature of tRNA that is important for its function in translation? O The…

A: Ans : Most important feature of tRNA that is important for its function in translation is - the…

Q: Select the processes that only happen inside the nucleus of a eukaryotic cell. Select all that…

A: Eukaryotic cells make up the eukaryotic body. These are more advanced organisms because their…

Q: How many tRNA molecules can associate with a ribosome at any given time during translation

A: The translation is the process of the formation of polypeptide chains of amino acids that lead to…

Q: What is the name for the complex that forms when many ribosomes translate the same MRNA at the same…

A: Polyribosomes are the complex of multiple ribosomes which translates the same mRNA.…

Q: what are the steps of translation in order based on when they occur? It would be nice if some…

A: Translation is the process by which a protein is synthesized from the information contained in a…

Q: What does the A site on the ribosome do?     What does the P site on the ribosome do?…

A: The ribosome is a complex molecule made up of ribosomal RNA molecules and proteins that functions as…

Q: CDNA contains introns O exons both introns and exons

A: cDNA or complementary DNA is the DNA strand that is synthesized from the spliced mRNA to contain…

Q: The ribosomes ratchet back and forth with every pt'ase reaction in order to move the tRNAS and the…

A: During translation,  tRNAs carry amino acids to the ribosome and join with their complementary…

Q: codons are part of the molecular structure of

A:

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: Match the following Prompts An AT-rich region found in eukaryotic promoters is called the box. The…

A: Transcription:  The process of synthesis of mRNA transcript from double stranded DNA template by the…

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: To which of the following tRNA structures is the amino acid attached with during aminoacylation?…

A: The production of polypeptide chain from the mRNA (contain genetic codons) is known as translation…

Q: Chaperones AUG Zwitterion Tarm Aminoacyl-tRNA synthetase III III E - A compound with no electrical…

A: Chaperones are proteins that aid in the folding, assembly, and stabilisation of other proteins in…

Q: ICH one is the next tRNA that will arrive to the "A" site of this ribosome? 000000 Gly Arg Glu Pro…

A: The A site is where the next tRNA molecule carrying an amino acid binds to the mRNA. The tRNA…

Q: An mRNA which has a structure of 5' GCGCGAUCUGCCGCUUCGCUACUA 3' Give the corresponding ntein seque…

A: A single-stranded RNA molecule usually gets to referred as the term messenger RNA (mRNA) is…

Q: During translation elongation cycle, which of the following step(s) is/are repeated for each amino…

A: Translation is a process by which proteins are synthesized from mRNA template. It involves all the…

Q: What's the tRNA strand for the following mRNA strand: AUGGCUAACCUUGUA

A: Gene expression is the procedure through which data from a gene is employed in the production of a…

Q: After the complete ribosome is assembled, what is the first amino-acyl tRNA to enter the ribosome's…

A: In the process of protein synthesis, ribosomes play a crucial role by facilitating the translation…

Q: What is the order of events leading to initiation of transcription in prokaryotes? Sigma factor DNA…

A: Note: According to the given guidelines, we are supposed to answer only 1 question. Please repost…

Q: Think about a ribosome that has already created the dipeptide Met-Ala and is in the process of…

A: Translation is the process of converting the mRNA to proteins Proteins are made of amino acids. The…

Q: Question / G 3 G2 G1 G 5 G 4 GGU AUG GCC AUG CUC CUc UUC ACG GAG UAC CGG R (the strand) Y CUC GAG…

A: In this image the process of transcription is shown where an mRNA is being translated with the help…

Q: What codon results in a release factor entering the ribosome? 5' M GPPP-…

A: Translation is a process of formation of protein from mRNA. This process takes place in the…

Q: in the endoplasmic reticulum and Golgi-complex, the determination of proper folding depends on what…

A: One of the most important post-translational modifications of proteins, protein glycosylation has a…

Q: Why is the position of the first AUG after the ribosome-binding site critical?

A: Introduction  The process of transcribing the mRNA into protein is called Translation. There are 3…

Q: This one is "charged" with an aminoacid. The specific sequence in the bottom is called the…

A: 5'-UCGGAAUGUGGUGGCAUACAGGCUUACAGAACUAAGUCUGAGAAU-3'As following the rules in genetic code the mRNA…

Q: The genetic code is made of 3 RNA nucleotides read 3-->5' 3 RNA nucleotides read 5'-->3' 3 DNA…

A: In molecular biology, the central dogma controls the process of transcription in which DNA is…

Q: Match the function with the appropriate protein or sequence:

A: tRNA is a short nucleotide chain with L-shaped structure. A tRNA molecule is required for…

Q: Transcript the template DNA (write in mRNA codons) *

A: The synthesis of messenger RNA with the help of DNA is called transcription. The main enzyme of…

Q: A tRNA that could “read” the 5’ GAA codon of glutamic acid would have the anticodon: Answer choices…

A: Transfer RNA (tRNA) is a type of RNA molecule that plays a crucial role in protein synthesis by…

Q: What is an exon? O a sequence of three nucleotides on tRNA complementary to the codon in mRNA a…

A: tRNA (transfer RNA) is a type of RNA molecule that plays a crucial role in protein synthesis. It is…

Q: Below is a diagram of charged tRNAs in the active site of the ribosome during translation of the…

A: Translation is the process of synthesis of protein. It takes place in the cytoplasm.

Q: Translation of mRNA Using the codon chart provided, translate the following messenger RNA sequence…

A:

Q: What will be the anticodon of the next tRNA added to the A site of the ribosome?

A: Codons are situated in on mRNA and anticodons are situated on tRNA.

Q: In which direction does the ribosome move along RNA?

A: Nucleic acids are macromolecules present in each and every cell of living beings. They are mainly…

Q: 29. Translation ends when O a release factor causes the translation complex to dissociate TRNA…

A: Translation is the process of formation of a polypeptide chain from an mRNA transcript. It occurs…

Q: The following non-coding sequence (i.e. template strand) is transcribed by the RNA pol II into a…

A: Identify the 5' and 3' ends of the DNA template strand.  Write down the complementary bases for each…

Q: Molecular Designs Large Ribosomal Subunit Small Ribosomal Subunit Translation of RNA into Proteins…

A: Synthesis of proteins occurs through translation in which RNA molecules serve as carriers of genetic…

Q: As the Ribosome keeps creating peptide bonds, empty tRNAs are ejected from the "E" site. Can you…

A: Chromosome is a thread-like, long structure that contains numerous genes on it. It is present safely…

Q: Describe the structure of a polysome, which is depicted.

A: Ribonucleic acid (RNA) is a genetic material that plays a vital role in ribosome and protein…

Q: What is the function of:  D loop - Anticodon Loop-  TC Loop-  acceptor stem-

A: The term tRNA stands for transfer RNA. tRNAs are small, generally having less than 100 nucleotides.…

Q: hange the peptide to Met Asp Asn Gly Leu Gly ?    Use the codon numbers to help describe where the…

A: Since you have posted a question with multi- sub parts , we will solve first three sub-parts for…

Q: E channel Charged tRNA Anticodon for START Initiating factors Release factors III III E III = exit…

A: The transition of mRNA into protein is known as translation, and it is a fundamental process in…