The genetic code is made of 3 RNA nucleotides read 3-->5' 3 RNA nucleotides read 5'-->3' 3 DNA nucleotides read 3'-->5' O 3 DNA nucleotides read 5'->3' An anticodon read by the ribosome The special shape of the Ribosome P-site The special shape of the Ribosome A-site A protein release factor that binds the start codon

The genetic code is made of 3 RNA nucleotides read 3-->5' 3 RNA nucleotides read 5'-->3' 3 DNA nucleotides read 3'-->5' O 3 DNA nucleotides read 5'->3' An anticodon read by the ribosome The special shape of the Ribosome P-site The special shape of the Ribosome A-site A protein release factor that binds the start codon

Name: The genetic code is made of3 RNA nucleotides read 3'-->5'3 RNA nucleo
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: The genetic code is made of3 RNA nucleotides read 3'-->5'3 RNA nucleotides read 5'-->3'3 DNA nucleotides read 3'-->5'3 DNA nucleotides read 5->3'An anticodon read by the ribosomeThe special shape of the Ribosome P-siteThe special shape of the Riboso

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter15: Genes And Proteins

Section: Chapter Questions

Problem 3VCQ: Figure 15.16 Many antibiotics inhibit bacterial protein synthesis. For example, tetracycline blocks...

See similar textbooks

Similar questions

Figure 15.16 Many antibiotics inhibit bacterial protein synthesis. For example, tetracycline blocks the A site on the bacterial ribosome, and chloramphenicol blocks peptidyl transfer. What specific effect would you expect each of these antibiotics to have on protein synthesis? Tetracycline would directly affect: tRNA binding to the ribosome ribosome assembly growth of the protein chain Chloramphenicol would directly affect tRNA binding to the ribosome ribosome assembly growth of the protein chain
Name (Last, First): DNA An RNA polymerase attaches to the DNA and transcribes the DNA to mRNA Ribosone BIO 340 Activity # 1: DNA and the Central Dogma Complete: DNA Coding 5' ATG TGG ATT CTC AAG ATC AAT AGT 3' DNA template 3 5' Cytoplasm Nuckus Nuclear pore ARNA Use the mRNA codon sequence and the genelic Landelable in order to find the amino acid (AA) sequence of the protein. Example: if mRNA sequence is GUU then the corresponding amino acid 3-letter is Valine (Val) and the corresponding amino acid 1-letter is V. mRNA codon 5' FIRST (5') LETTER tRNA codon 3 U AA 3-letter AA 1-letter Amino acid AA - Amino acid A tRNA THE GENETIC CODE New protein being built U Pie (F) ասա UUC) ԼԱՔ Uva) Lou (L) Leu (L) val (M) Use numbers 1 to 3 to indicate the correct order of the flow of biological information. Translation Replication Transcription Hydroxyl group Deoxyribose sugar DNA's charge is negative due to following (circle the correct one): An alpha helix and a beta sheet in a protein are a type…
What section in the ribosome will the first anticodon enter? E site A site P site
polypeptide chains Which of the following statements is/are correct? Please make sure to sel correct answer options. Letter E is near the C-terminal end of the protein Letter B represents the 5' end of the mRNA Letter D represents the ribosome that near the end of translation as cor to the other three ribosomes shown in the figure. This process is happening in an eukaryotic cell. O Letter C represents represents charged tRNA Letter A represents the 3' end of the template DNA strand. Letter A represents the 5' end of the template DNA strand. This process is happening in a prokaryotic cell.
Once there is a tRNA in the "A" site, the Ribosome will create a bond and start creating a polypeptide. Large Ribosomal Subunit Small Ribosomal Subunit zero 2 N-terminus 1 Protein Exit Channel E Methionine Met M tRNA How many water molecules are created by this bond? 3 Met Ribosome us Cysteine Cys C *** tRNA
3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would…
es/2015347/quizzes/5825805/take The "factory" itself, made of two [Choose] subunits [Choose ] FRNA The site from which the growing polypeptide chain exits the ribosome RELEASE FACTOR CODON RIBOSOME P SITE The processed copy of DNA that UGA carries its sequence of codons to the TRNA ribosome AUG ANTICODON MRNA The carriers of each unique amino acid E-SITE to A-site of the ribosome The three letter message carried to [ Choose ] the ribosome on the "toes" of the TRNA The site from which the now empty [ Choose ] TRNA leaves the ribosome The first codon required to initiate [ Choose ] translation (on the mRNA). The binding chemical that comes along once the STOP codon is encountered: disassembles the ribosomal complex [Choosc] hp
A Section of a GeneAAG ATA CAG GCT CGG TAA For the DNA sequence shown above, identify the following: mRNA codons tRNA anticodons amino acids
Table 8.2: Transcription and translation of the first 7 codons in the B-globin chain of hemoglobin. Normal Sequence Mutated Sequence DNA DNA amino acid DNA DNA amino Codon MRNA Codon MRNA coding template strand coding template strand strand acid code code strand sequence sequence G 1 1 G G C 2 A 2 A 3 G G A A 4 4 C G A G G G G 7 A 7 A G G Shape of RBC Shape of RBC 23 3.
Charged tRNAS enter the ribosome in which site? A site E site O P site
Translation of mRNA Using the codon chart provided, translate the following messenger RNA sequence into an amino acid sequence (protein). AUG AAA GGU CAC CCC TAG
Match the descriptions to the molecules of transcription and translation. MRNA [ Choose ] v DNA [ Choose ] FRNA [ Choose ] TRNA [ Choose ]