Think about a ribosome that has already created the dipeptide Met-Ala and is in the process of adding the third amino acid, which is a Leu. We don't know everything about this reaction mechanism, but we know that one of the direct products of this reaction, according to our coverage, will be: O a tRNA with anticodon specifving Leu

Think about a ribosome that has already created the dipeptide Met-Ala and is in the process of adding the third amino acid, which is a Leu. We don't know everything about this reaction mechanism, but we know that one of the direct products of this reaction, according to our coverage, will be: O a tRNA with anticodon specifving Leu

Name: Think about a ribosome that has already created the dipeptide Met-Ala
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Think about a ribosome that has already created the dipeptide Met-Ala and is in the process of adding the third amino acid, which is a Leu.We don't know everything about this reaction mechanism, but we know that one of the direct products of this re

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 1CT

See similar textbooks

Similar questions

Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
Which of the triplets below is a possible anticodon for a tRNA that transports Leucine (Leu) to a ribosome? Second letter C UGU cys UCU1 UCC UCA UCG UAU Tyr UACS Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUU UGCS Phe UUC U UUA UUG FLeu CAU HiS CGU] CUU CUC Leu CCU ССС CCA CCGJ CACS CGC Arg CGA CAA GIn Pro C CUA CUG J CAG S CGG AUU AUC lle AUA AAU Asn AGU ser ACU АСС Thr ACA AAC AAA ys AGA Arg AAG J AGC AUG Met ACG Lys AGG J GUU GUC CUA Val GAU ASP GCU GACJ GCC FAla GGU] GGC CGA Gly CCA C CAA M UCAG Third letter UCAG UCAG First letter
A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:Strand A - TACGATGACGATAAGCGACATAGC - Strand B - ATGCTACTGCTATTCGCTGTATCG -Which is the transcribed (template) strand? Write the sequence of the resulting mRNA transcript. Add labels to the strands above to show the 3’ and 5’ ends.
An anticodon on a TRNA has the sequence 3' UAC 5. What amino acid would it be charged with?
TRNAS are 'charged' or activated by aminoacyl TRNA synthetases. Select the correct statements regarding this process. The process is dependent on interactions between ribosomes and aminoacyl TRNA synthetases. The aminoacid is added to the D-loop of the tRNA. Aminoacyl TRNA synthetases are pre-associated with tRNAS. The amino acid is attached to the terminal to the 3' hydroxyl of an adenine in the acceptor arm. The process requires an aminoacyl-adenylate intermadiate. QUESTION 19 Select the correct statements regarding myosin-mediated contraction the sarcomere. O Ca2+ is required for the binding of myosin to f-actin. Myosin and f-actin are randomly distributed in the sarcomere. Physical pulling of the actin microfilament requires three distinct conformation changes on myosin that involve ATP binding, ATP hydrolysis and sequential release of inorganic phosphate and ADP. Myosin-mediated contracted is ubiquitous across all cell types. O O O O
Which one is the next tRNA that will arrive to the "A" site of this ribosome? Gly Previous Arg Glu Pro Val OCys U A G G Met Pro U A G G
Using the table below, which amino acid would you expect a tRNA with the anticodon 5'-AGC-3' to carry? Ala Arg Asp Asn Cys Glu Gin Gly His O Ser O Ala O Arg Thr ទទខ | ៖ ≡ គគគិត
In bacteria, researchers have isolated strains that carry mutations within tRNA genes. These mutations can change the sequence of the anticodon. For example, a normal tRNATrp gene encodes a tRNA with the anticodon 3′–ACC–5′. A mutation can change this sequence to 3′–CCC–5′. When this mutation occurs, the tRNA still carries a tryptophan at its 3′ acceptor stem, even though the anticodon sequence has been altered. A. How would this mutation affect the synthesis of polypeptides within the bacterium? B. What does this mutation tell you about the recognition between tryptophanyl-tRNA synthetase and tRNATrp? Does the enzyme primarily recognize the anticodon or not?
Below is a diagram of charged tRNAS in the active site of the ribosome during translation of the MRNA into protein. What would be the codon in the mRNA that base pairs with the anti-codon in the t- RNA charged with Glu (Glutamic acid) ? HINT: Check the genetic code table/chart. X. Ala Arg Cys Gly Met Trp Leu Glu TRNA B TRNA A A 5'-AAC-3' 5'-CUU-3' 5'-GAA-3' 5'-AUG-3'
The piece of eukaryotic mRNA below includes the region that codes for the binding site for the initiator tRNA needed in translation. 5'-GUUUCCCGUAUACAUGCGUGCCGGGGGC-3' Using the table below, which amino acid would you expect to be on the tRNA that is the first to bind to the A site of the ribosome? AGC AGA AGG GCA CGA CUA GGA GGC GCC CGC AUA CUC AGU CCA UCA ACA CCC UCC ACC UUC CCG UCG ACG UUU CCU UCU GCG CGG GAC AAC UGC GAA CAA GGG CAC AUC CUG AAA GCU CGU GAU AAU UGU GAG CAG GGU CAU AUU CUU AAG AUG Ala Arg Asp Asn Cys Glu Gin Gly His lle Leu Lys Met Phe Pro Ser O methionine O arginine O cysteine Ovaline UUA UUG OOOO GUA GUC UAC GUG ACU UGG UAU GUU Thr Trp Tyr Val UAA UAG UGA stop
Why do aminoacyl-tRNA synthetases need ATP? to prevent the 2'OH from being aminoacylated to provide energy to drive the reaction to add the 3' adenosine onto the tRNA to add a leaving group on the amino acid
Which of the following cannot be said regarding aminoacyl tRNA synthetase? It is essential for the correct reading of codons. A single tRNA synthetase can attach different amino acids to their corresponding tRNA. It is first activated when it catalyzes a reaction between ATP and an amino acid to form an aminoacyladenylic acid (amino acyl-AMP). It is responsible for the attachment of the correct amino acid to the correct tRNA. There is a different tRNA synthetase for each amino acid that will be attached to a tRNA.