The antibiotic erythromycin disrupts protein synthesis by binding to the 50 S subunit and preventing ribosomal translocation. No other step in protein synthesis is affected. If you are performing an in vitro translation reaction and add erythromycin just before the 3rd bond that is about to be made and wait a few minutes to look at the ribosome, you will find the tRNA in site A carrying? an amino acid a polypeptide neither O either one

The antibiotic erythromycin disrupts protein synthesis by binding to the 50 S subunit and preventing ribosomal translocation. No other step in protein synthesis is affected. If you are performing an in vitro translation reaction and add erythromycin just before the 3rd bond that is about to be made and wait a few minutes to look at the ribosome, you will find the tRNA in site A carrying? an amino acid a polypeptide neither O either one

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 14P

See similar textbooks

Similar questions

Which of the triplets below is a possible anticodon for a tRNA that transports Leucine (Leu) to a ribosome? Second letter C UGU cys UCU1 UCC UCA UCG UAU Tyr UACS Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUU UGCS Phe UUC U UUA UUG FLeu CAU HiS CGU] CUU CUC Leu CCU ССС CCA CCGJ CACS CGC Arg CGA CAA GIn Pro C CUA CUG J CAG S CGG AUU AUC lle AUA AAU Asn AGU ser ACU АСС Thr ACA AAC AAA ys AGA Arg AAG J AGC AUG Met ACG Lys AGG J GUU GUC CUA Val GAU ASP GCU GACJ GCC FAla GGU] GGC CGA Gly CCA C CAA M UCAG Third letter UCAG UCAG First letter
During translation, the tRNA antlicodon sequence G-A-U vyould blnd to which MRNA codon (plck one of the cholces I -V below)? Note: all of the sequencos for tho quostlon and answors use the standard convention for representing ollgonuclootidos discussed In class whoro tho 5'-ond Is at the loft and the 3'-ond Is at the right. I) G-A-U II) U-A-G I) C-U-A IV) A-U-C V A-T-C OA. none of the cholces OB. IV Oc." OD.! OE, II
The following segment of DNA in a hypothetical model organism encodes a polypeptide containingSEVEN amino acids. Pretend this short polypeptide is a completely functional enzyme. DNA tripletsencoding the translation initiation (or start) codon and a stop codon are included in the sequence.3 •GGGTACGATCGGAAAGTTGGTTCICCGGTATAGCTG5'5•CCCATGCTAGCCTTTCAACAAAGAGGCCATATCGAC.3'a. Label which of the DNA strands is the template strand and which is coding strand. b. Below, show sequence and the polarity of the mRNA encoded by this 'gene'. Determine theamino acid sequence of the polypeptide (use three letter codes for the amino acids) andidentify the N- and C- terminal ends of the polypeptide. please help. I am confused. c. Which of the 7 side chains in this polypeptide can form hydrogen bonds with polar molecules(like water)? Place a circle around these.d. Some amino acids on a polypeptide can be modified post-translationally. Thesemodifications may have some effect on the function of the…
For the tRNA below, determine which amino acid it is charged with. attached amino acid G G GA 5' end c GOGGAUUU CUC G GAGC G C GCSAK & A 3' end ASSAGGCUUAA GACAC CCUGUG עכטט A GAAD anticodon C T U anticodon loop A G
otein structure urs Chaperones AUG Zwitterion Tarm Aminoacyl-tRNA synthetase Unanswered 0 0/1 answered III I III A compound with no electrical charge made up of separate molecules with positive and negative charges that balance each other out. Attaches the appropriate amino acid to a tRNA molecule based on its anticodon. Surprisingly contains a thymine in it despite being a piece of RNA. Recognized by the anticodon UAC. Small group of proteins that assist protein folding. Submit
Using the given information, determine the correct order of the following events during translation: TRNA-methionine is cleaved and moves the empty tRNA to E site & is released, TRNA with polypeptide chain moves to P site. Second tRNA binds to 1. Step 1 codon in A site 2. Step 2 Ribosome arrives at stop codon & polypeptide chain is released from TRNA 3. Step 3 4. Step 4 A peptide bond is created between the first amino acid and the second amino 5. Step 5 acid. 6. Step 6 TRNA-methionine binds to the start codon and the large ribosomal unit binds Small subunit scans MRNA until it reaches start codon
An anticodon on a TRNA has the sequence 3' UAC 5. What amino acid would it be charged with?
Think about a ribosome that has already created the dipeptide Met-Ala and is in the process of adding the third amino acid, which is a Leu. We don't know everything about this reaction mechanism, but we know that one of the direct products of this reaction, according to our coverage, will be: O a tRNA with anticodon specifving Leu
codon: 1 2 3 4 5 6 7 sequence: TAC ATG GAC AAT GAT TAG GGG 1. What is the sequence of the peptide that would result following translation with a ribosome? Write your answer like this Met Ala Gly...... 2. What mutation(s) would change the peptide to Met Asp Asn Gly Leu Gly ? Use the codon numbers to help describe where the mutation is located . What mutation(s) would eliminate peptide translation? Use the codon numbers to help describe where the mutation is located
Using the table below, which amino acid would you expect a tRNA with the anticodon 5'-AGC-3' to carry? Ala Arg Asp Asn Cys Glu Gin Gly His O Ser O Ala O Arg Thr ទទខ | ៖ ≡ គគគិត
100All tRNA molecules have poly (A) tails at their 3' end. Yesorno
Which one is the next tRNA that will arrive to the "A" site of this ribosome? Gly Previous Arg Glu Pro Val OCys U A G G Met Pro U A G G