What is an exon? O a sequence of three nucleotides on tRNA complementary to the codon in mRNA a coding sequence of DNA or mRNA a noncoding sequence of DNA or mRNA a sequence of three nucleotides in mRNA that code for a specific amino acid

Q: Describe the process by which the information in eukaryotic gene is transcribed and translated into…

A: Eukaryotic gene expression is a complex process that involves transcription as well as translation.…

Q: If a scientist synthesizes a DNA molecule with a nucleotide base sequence to TACGGGGGAGGGGGAGGGGGA…

A: There are 4 nitrogen bases present in DNA, these are Adenine, Thymine, Cytosine, and Guanine.…

Q: The following is a strand of mRNA: CAA GUG AAA ACA How many amino acids does the mRNA strand above…

A: The protein synthesis process requires the genetic material in the form of DNA to be transcribed…

Q: In which of the following would you find the start codon sequence of a gene? mRNA DNA and…

A: Codons are made up of three consecutive nucleotides. The sequence of start codon is AUG. It…

Q: The following sequence represents triplets on DNA: TAC CAG ATA CAC TCC CCT GCG ACT   Give the mRNA…

A: Answer: CENTRAL DOGMA : It is the complete process of replication of DNA , transcription of DNA  and…

Q: Which of the following is a true statement concerning codons  A codon Will be read by RNA…

A:

Q: The molecule(s) that actually recognize and translate the genetic code into polypeptide sequence are…

A: Translation of genetic code into polypeptide chain is called translation.

Q: Draw a line representing mRNA that has already been processes (introns removed, cap and tail added).…

A: Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: What is the tRNA strand for the following mRNA strand: CAGGAUGAAUUGCUC

A: To determine the tRNA (transfer RNA) sequence corresponding to the given mRNA (messenger RNA)…

Q: Which codon codes for the C-terminal residue in the polypeptide structure shown below? H3N 'N' NH3 H

A: GENETIC CODE is the relation between the base sequence of a gene and the amino acid sequence of the…

Q: The sequence: ATTGCCGACGACTTG is complementary to a sequence that is used as a template in…

A: (-) Sense

Q: What happens if you replace the trp codons in the trp leader sequence with codons specifying…

A: If the tryptophan is replaced in the trp codon sequence with codons specifying isoleucine, the cell…

Q: A small section of mRNA codons has the following sequence: CCU GUA CAC GUC Some Amino Acids Stop…

A: mRNA is the messenger RNA which is used as a template strand for the protein synthesis.

Q: In Figure 14-9, how are the positions of codonsdetermined?

A: Ans: Codon: The set of trinucleotide sequence of DNA or RNA is referred to as codon.

Q: An mRNA encodes a polypeptide that is 312 amino acids in length. The 53rd codon in this polypeptide…

A: The translation is the second part of the central dogma of molecular biology: RNA → Protein. It is…

Q: The amino acids listed above that are coded by the mRNA codon

A: Protein synthesis is a major process inside our body .Our body has complex system for protein…

Q: Can you give further explanations regarding this topic? We are about to tackle this in our next…

A: Our DNA is made up of four bases which are A= Adenine, C= Cytosine, G= Guanine, and T= Thymine. Here…

Q: Which nucleic acid has a double helix structure?     tRNA     mRNA     rRNA     DNA

A: Nucleic acids that are present in the environment can be of two different types based on the type of…

Q: Which of the following sentences is INCORRECT: The aminoacyl TRNA synthetase charge O the TRNA…

A: tRNA is a type of RNA molecule that helps decode a messenger RNA sequence into proteins. tRNA has…

Q: and each codon is made up of three nucleotide bases. How might an extra single base INSERTION into…

A: Any abrupt changes in DNA nucleotide is called muttaion.Depending on where the changes occurred…

Q: Introns are intervening sequences; what are exons?

A: A gene is an essential unit of heredity and a sequence of nucleotides in DNA or RNA that encodes the…

Q: Relaxed pairing specificities in the third-base position of a codon

A: Referring to the genetic code, "wobble" means relaxed pairing specificities in the third-base…

Q: Which of the following base pairings are allowed between an anticodon and the 3' base of a codon,…

A: According to wobble hypothesis, the third nucleotide of anticodon is a wobble and can base pair with…

Q: Noncoding Strand -> 5’ - G   C     C     A   G     G   T       C     A     G   G     T -   3’…

A: The terms used in the question represents the molecules involved in gene expression. A gene is a…

Q: The genetic code is made of 3 RNA nucleotides read 3-->5' 3 RNA nucleotides read 5'-->3' 3 DNA…

A: In molecular biology, the central dogma controls the process of transcription in which DNA is…

Q: The following base sequence is a complete polynucleotide made in a bacterial cell. AUG, GCC, AUG,…

A: The process of transcription entails creating mRNA from a DNA template. A complementary mRNA strand…

Q: What is genetic code? How many codons are there? Justify that genetic code is universal

A: The study of genomes' structure, operation, development, the mapping process, and modification is…

Q: Which of the following is located at the C-terminus of a newly synthesized eukaryotic proteins?…

A: Initiation of translation occurs when the small ribosomal subunit binds with initiation factors and…

Q: Below is a diagram of charged tRNAs in the active site of the ribosome during translation of the…

A: Translation is the process of synthesis of protein. It takes place in the cytoplasm.

Q: Which of the following is NOT a property of the genetic code? O It specifies the amino acids within…

A: The genetic code is the set of rules that govern how the nucleotide sequence of DNA is translated…

Q: What are the specific steps of eukaryotic translation? Be sure in your discussion that you include…

A: In transcription, a cell “copies” DNA sequence to a complementary RNA molecule. Then, in…

Q: What is the mRNA strand of the following DNA (coding) strand: ATGGCTAACCTTGTA

A: Gene expression is the process through which data from a gene is employed in the synthesis of a…

Q: Which of the following mRNA codons could be changed to a stop codon by a single base pair…

A: A codon consists of three-nucleotides (A, G, C, or U) of RNA and carries the genetic information.…

Q: Look at the MRNA strand below. There are at least a few bases before the "AUG" or the start codon.…

A: Several codons or triplet bases make up the universal genetic code. Over time, the standard code has…

Q: A small section of mRNA codons has the following sequence: UGU  GGU  CAA  CCG Some Amino Acids…

A: mRNA is a ribonucleotide sequence produced as a result of transcription from DNA. Once the mRNA is…

Q: How many amino acids would be in this protein? Which of the five types of nitrogen bases is not…

A: Four types of aminoacids would be in this protein   UCU--Serine AUU--Isoleucine GGG---Glycine…

Q: A Section of a Gene TGC GTG TAC CTA CCA For the DNA sequence shown above, identify the following:…

A: The given DNA sequence is as follows,  TGC GTG TAC CTA CCA

Q: What is the sequence of the MRNA codon that binds to the anticodon 3'-AAG-5'? 5'-AAG-3' 5'-TTC-3'…

A: Anticodon:  A trinucleotide sequence that is complementary to a matching codon in a messenger RNA…

Q: If methionine is the first amino acid incorporated into a heptapeptide, what is the sequenc of the…

A: Each group of three bases in a mRNA constitutes a codon. Each codon specifies an amino acid.

Q: help

A: The mutations causing most likely (1) to least likely (4) a loss of the function of the encoded…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.