Eukaryotic DNA contains introns, which interrupt coding regions (exons). Exon Intron Exon Intron Exon Eukaryotic DNA Transcription generates pre-MRNA (precursor MRNA) that contains introns. A cap and poly A tail are then added. Сар Poly A tail Pre-MRNA Splicing removes introns to create functional MRNA. MRNA MRNA is transported out of the nucleus to be translated in the cytoplasm. O FIGURE 7.17 Splicing of Eukaryotic RNA

Q: Why is it that pre-mRNAs are capped, but tRNAs and rRNAs are not?

A: Ribonucleic acid (RNA) is a polymeric molecule important in various biological roles such as…

Q: What defines a genome?

A: A branch of molecular biology dealing with the evolution, structure, function, as well as mapping of…

Q: What is meant by the statement “The genetic code is universal”? What is the significance of this…

A: Genetic code is the code for the expression or improvisation of proteins which comes from DNA via…

Q: Why is a trimming process important in converting precursors of tRNA and rRNA to the active forms?

A: Ribonucleic acid is fundamental in different biological roles in coding, translating, regulation,…

Q: Propose an evolutionary explanation for introns. Why might they have evolved?

A: The mutations are the permanent alterations in the genetic constitution of an organism. The…

Q: What is a gene? Why are genes for rRNA and tRNA considered to be genes even though they do not…

A: Structurally, RNA (RNA), is kind of like sugar Nucleic Acid(DNA). However, whereas polymer molecules…

Q: Why are introns formed if they are going to be degraded? What happens to the chemicals that make up…

A: Introns, from this point of view, have a significant reason. They fill in as problem areas for…

Q: What is a genomic library?

A: Deoxyribonucleic acid (DNA) is a molecule composed of two polynucleotide chains. It coils around…

Q: Occurrence of each codon on human transcriptome?

A: Replication, transcription , and translation are the three main processes that cells use to preserve…

Q: What is a gene? Provide at least two different definitions and explain.

A: Gene is a segment of DNA (deoxyribonucleic acid) of an individual that is responsible for the…

Q: What is a gene? How many oxons are in the basic structure of a gene

A: A gene is in charge of determining an organism's physical characteristics and regulating its…

Q: What are repetitive sequences ?

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: Sixty-four different codons translate into only 20 amino acids. How are tRNAS adapted to address…

A: Hello Dear Students, Q: Answer: Most amino acids are specified by more than one codon in the genetic…

Q: What is the genetic code and what is it used for?

A: The translation is the process of synthesis of proteins or polypeptide chains. The information from…

Q: how is The Genetic Code Is Almost,but Not Quite, Universal?

A: The genetic code is the set of rules used to translate information encoded within the messenger…

Q: The genetic code uses three bases to encode one amino acid. Why can't the code use only two bases to…

A: Genetic code is a triplet code that consist a set of three nucleotide bases, known as codons. Each…

Q: When is a DNA sequence said to be conserved?

A: DNA (Deoxyribonucleic acid) and RNA (Ribonucleic acid) are the two important classes of nucleic…

Q: What are the specific steps of eukaryotic translation? Be sure in your discussion that you include…

A: In transcription, a cell “copies” DNA sequence to a complementary RNA molecule. Then, in…

Q: The human genome has 3.3 billion bases, of which 3% codes for protein. If a codon were four letters…

A: In most organisms, genetic information is stored in the form of the nucleotide sequence of DNA. This…

Q: Are introns coding or noncoding?

A: Introns and exons are part of the genes. Introns are present in the initial RNA transcript known as…

Q: ACCUAACGCGCCACACGUUCUCUAUUACCCCCC

A: In eukaryotic genes, the coding regions (exons) are interspersed with non-coding regions (introns).…

Q: What is a gene? What does "base sequence" mean? If the base sequence of a segment of a molecule of…

A: Hello! Since you have posted multiple questions, we are answering only the first two questions.…

Q: What are some of the modifications in tRNA that take place through processing?

A: The tRNA processing results in mature tRNA molecules. It involves specific cleavage by enzyme…

Q: What is meant by the statement “The genetic code is universal”? What is the significance of this…

A: DNA is deoxyribonucleic acid that contains genetic information. Gene is a segment of DNA that can…

Q: What causes exon shuffling?

A: Exon shuffling is a molecular mechanism for the formation of new genes. It is a process through…

Q: What mutations can be caused by a single base change in coding exons?

A: A mutation is  any kind of alteration in the DNA/mRNA sequences. It is mainly caused due to the…

Q: What is a transcript in biology?

A: RNA (ribonucleic acid) is a polymer of nucleotides and is composed of a pentose sugar, a nitrogen…

Q: Define gene, cistron, exons, introns, and UTR.

A: Hereditary can be defined as the transfer of the characters from one generation to another. The…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.