The genetic code uses combinations of 3 RNA bases as letters, each triplet specifies only one amino acid uses combinations of 3 RNA bases as letters, each triplet can specify more than one amino acid uses combinations of 3 DNA bases as letters to specify the amino acids uses combinations of 3 tRNA bases as letters to specify the amino acids

Q: In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Then,…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: What is meant by the statement “The genetic code is universal”? What is the significance of this…

A: Genetic code is the code for the expression or improvisation of proteins which comes from DNA via…

Q: Now we need to know which amino acid the tRNA is carrying. We can do this on paper using the…

A: Strand mRNA codon tRNA anti-codon AA(short) AA(full name) Strand1: C-G-T-T-A-T-C-T-C-A-T-A-G-C-T…

Q: Several different nucleic acids are involved in the process of getting a protein produced from a…

A: Sense strand is that strand of DNA double helix which has the translatable protein code in the 5'-3'…

Q: b) Draw a diagram to show how nucleotides are organised in the structure of DNA. Note: You need only…

A: The four most important biomolecules in living things are carbohydrates, amino acids, lipids, and…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: Which of the following is a true statement concerning codons  A codon Will be read by RNA…

A:

Q: In RNA, an atypical base pair is able to form between guanine and uracil. This base pair allows a…

A: Introduction A Base Pair Is Made Up Of Two Chemical Bases That Are Bound Together To Form A "rung Of…

Q: Part of being a detective is being able to decode secret messages left behind by certain…

A: The given DNA sequence is: 5'- TATGCTAGGCATTGTCGTAGGCATACG -3' 3'- ATACGATCCGTAACAGCATCCGTATGC -5'

Q: and each codon is made up of three nucleotide bases. How might an extra single base INSERTION into…

A: Any abrupt changes in DNA nucleotide is called muttaion.Depending on where the changes occurred…

Q: Experiments have demonstrated that the "words" of the genetic code (the units that specify amino…

A: The genetic code is a set of rules that specifies how the information in DNA and RNA molecules is…

Q: An RNA molecule has the following percentages of bases: A = 27%, U = 38%, C=20%, G= 15%. (A) Is this…

A: DNA is composed of nucleotide. In nuclear tide there is one ribose sugar, one phosphate  molecule…

Q: The genetic code uses three bases to encode one amino acid. Why can't the code use only two bases to…

A: Genetic code is a triplet code that consist a set of three nucleotide bases, known as codons. Each…

Q: Here is our DNA sequence: T-A-C-A-T-G-T-T-T-A-G-G-T-C-C-A-C-C-C-G-T-G-G-G-A-C-T Write the RNA…

A: Introduction  The process by which the genome's DNA is copied in cells is known as DNA replication.…

Q: How many possible nucleotide sequences could code for a peptide with the sequence "MRRTGERS*"? (Note…

A: The given sequence is 'MRRTGERS*'. The amino acid sequence is…

Q: Indicate whether there is matching (1) or base complementarity (2) between the following nucleic…

A: The template strand is also called antisense strand.  Biosynthesis of mRNA using antisense strand of…

Q: Transcribe the following DNA sequence into codons.…

A: Transcription is a process in which there is formation of messenger RNA from the DNA template In…

Q: A Section of a Gene CTA AAA TAG TCT For the DNA sense strand sequence shown above, identify the…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: How many comparisons are needed to count the number of duplicates in a list? How many comparisons…

A: Codons are triplets of nucleotides (4 types of nucleotides, A, U, G, C) found on mRNA sequence which…

Q: What is the base sequence of the mRNA synthesized from the following DNA template strand?…

A: In order for a gene to be converted into a functional protein, two processes must take place namely…

Q: Which of the following statements is false about the structure of TRNA? O Because of hydrogen bonds,…

A: RNA is ribonucleic acid which is single stranded .It is of three types :- A ) mRNA B ) tRNA C ) rRNA

Q: The human genome has 3.3 billion bases, of which 3% codes for protein. If a codon were four letters…

A: In most organisms, genetic information is stored in the form of the nucleotide sequence of DNA. This…

Q: The exons and introns of a gene are shown below. Introns are shown as black bars. Exons are numbered…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: What amino acid is coded by each codon? Note: Reference the Genetic code table for additional…

A: In molecular biology, the genetic code is the set of rules used by living cells to translate…

Q: As a genetic engineer, you have been given the following task: alter a protein’s structure by…

A: Protein is a polymer of amino acids connected together via peptide bond. In a cell, proteins are…

Q: The following fictitious double-stranded bacterial DNA sequence codes for a fictitious prot Both…

A: As per the guidelines, this is a question with multi-subparts, we will solve the first three…

Q: A small section of a gene for a protein has the following nucleotide sequence: GGC TCG GTA ACA TAC…

A: Mutation: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to…

Q: What is meant by the universality of the genetic code?

A: The genetic code is a collection of three-letter nucleotide combinations known as codons, each of…

Q: look at the code: import random # Define the DNA nucleotides nucleotides = ["A", "T", "G", "C"] #…

A: import random# Define the DNA nucleotidesnucleotides = ["A", "T", "G", "C"]The above code  defines…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.