How many base-pairs would have to be deleted in a mutational event to eliminate a single amino acid from a protein and not change the rest of the protein? You must enter a whole number (no text)

Q: Why is deleting one nucleotide generally more detrimental than deleting three?

A: Nucleotides are monomeric units of nucleic acids.They are phosphate esters of nucleosides and made…

Q: In addition to the standard base-paired helical structures, DNA can form X-shaped hairpin structures…

A: Cruciform DNA is a form of non-B DNA that requires at least a 6 nucleotide sequence of inverted…

Q: The sequence below is a template strand sequence for a gene (a very short one!). Identify the start…

A: DNA -> Transcription -> mRNA -> Translation -> ProteinTranscription is the synthesis of…

Q: The effect of base-pair substitution mutations on protein function varies widely from no detectable…

A: A mutation is any alteration in the nucleotide sequence that changes the sequence of DNA, RNA and…

Q: DNA            A G T A C C G G G C A A A C T G C A T T G T G            mRNA U C A U G G C C C G U…

A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…

Q: Part of being a detective is being able to decode secret messages left behind by certain…

A: The given DNA sequence is: 5'- TATGCTAGGCATTGTCGTAGGCATACG -3' 3'- ATACGATCCGTAACAGCATCCGTATGC -5'

Q: Representations of sequencing chromatograms for variants of the a chain of human hemoglobin are…

A: The sequencig chromatograms given in question are generated as we conduct Automated DNA sequencing…

Q: missense,

A: 1. Non- conservative missense mutation occur , when G was substituted with C .

Q: Please by using the first base of each as the first triplet in a condo, how do I translate two…

A: Translation Translation is the process in which the mRNA or messenger RNA is get translated. mRNA of…

Q: DNA molecules consist of chemically linked sequences of the bases adenine, guanine, cytosine, and…

A: Codon is a base triplet that exists in DNA. DNA gets transcripted to mRNA which then translates to…

Q: polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid…

A: Wild type sequence : Met Ser Pro Arg Leu Glu Gly    Mutant 1: Met Ser Pro   After pro, the peptide…

Q: Lactose permease, a protein of E. coli, is composed of a single polypeptide that is 417 amino acids…

A: Lactose permease Its belong to transmembrane protein family. The transport mechanism of lactose…

Q: If an average amino acid is 110Da, how many amino acids would you predict to have in a polypeptide…

A: This process is called the central dogma of life. DNA is transcribed into mRNA and mRNA is…

Q: The following DNA sequence is derived from the middle of an exon of a eukaryotic gene. This sequence…

A: The Central Dogma concept states that DNA is duplicated into DNA. RNA is formed from DNA and…

Q: Hello , please help me with this question. I am struggling with naming the Amino Acid sequence from…

A: Codon is the triplet of either DNA or RNA nucleotides which codes for a specific amino acid during…

Q: A normal hemoglobin protein has a glutamic acid at position 6; in sickle-cell hemoglobin, this…

A: In the normal hemoglobin molecule protein, has a glutamic acid (an amino acid) at the sixth position…

Q: Amino acids carried by each tRNA (according to dictionary, below)

A: Transfer RNA (tRNA) molecules are responsible for carrying specific amino acids to the ribosome…

Q: Give the amino acid sequence with some little explanation please.   5′…

A: Decoding a sequence of bases in mRNA results in the formation of either peptide, polypeptide, or…

Q: If the mRNA molecule from your answer to the previous question is going to be translated into a…

A: The gene is the portion of DNA that codes for a specific protein. First, the DNA is converted to…

Q: Each of the following pairs of primers has a problem with it. Tell why the primers would not work…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5'    Q:  Based on written…

A: The DNA has two strands one is the Template strand and other is the coding strand. Based on the…

Q: Give the coordinate for the last base of the first exon for tra-RB; type a number as in 7,000…

A: Introduction :  In mRNA transcripts, introns are referred to as interfering sequences. These are the…

Q: What are the sequences of all the possible tripeptides that contain the amino acids aspartic acid,…

A: The polypeptide chain is made up of amino acids which are joined by the polypeptide chain.

Q: Listed below are five amino acids. Use the genetic code to determine the exact codon for each amino…

A: Transition refers to a point mutation that changes a purine nucleotide to another purine or a…

Q: Using the genetic code, interpret the following set of nucleotides.…

A: Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum synthesize…

Q: Amino acids have an average molar mass of 100 g/mol.How many bases on a single strand of DNA are…

A: Given: molar mass = 5.0×105 g/mol = 500000 g/mol average molecular weight of an amino acid = 100…

Q: What is a motif? Why is it useful for computer programs to identifyfunctional motifs within amino…

A: Bioinformatics has permitted molecular biologists to store and analyze a large amount of data…

Q: Write the mRNA sequence (5′ to 3′) that would result from transcription of the DNA sequence. (Note:…

A: Deoxyribonucleic acid or DNA is the type of nucleic acid present in the nucleus of the cell. It is…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.