Amino acids carried by each tRNA (according to dictionary, below)

Q: Using the following sequence and the amino acid chart, please give the amino acid sequence:…

A: The genetic material in majority of complex higher organisms and various viruses is DNA or…

Q: List anticodon sequences on the tRNA’s carrying the amino acids: Ala, Phe, Leu, Tyr

A: In the process of translation, the mRNA-carrying codons are coded into the anticodons, which help to…

Q: How will you best describe tRNA, support your answer with a proper diagram?

A: Ribonucleic acid (RNA) is a polymeric molecule essential in various biological roles in coding,…

Q: Which enzymes and tRNAs are known as aminoacyl-tRNA synthetases?

A: BASIC INFORMATION ENZYMES They are the catalyst. They help in accelerating the chemical reaction.…

Q: Define transfer RNA (tRNA)

A: Ribonucleic acid [RNA] is single-stranded nucleic acids that are composed of a nitrogenous base, a…

Q: Describe the structure and function of tRNA

A: BASIC INFORMATION  RNA  It stands for Ribonucleic acid. They are of three types;  messenger RNA…

Q: Sequence: CUCAACACGCCGCUCAGUGCCCUCGUGAUGAAGCAUAGGGGAAAC   By in vitro translating the mRNA, you…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: How many amino acids are in KMT2D peptide sequence?

A: Introduction  Organic substances known as amino acids have both functional groups for amino and…

Q: This is the three-letter code for the amino acid that is the most geometrically constricted amino…

A: Amino Acids are the organic compounds that combine to form proteins, hence they are referred to as…

Q: Define messenger ribonucleic acid (mRNA)

A: Answer: Introduction: RNA molecule consists of four nucleotide bases these are adenine (A), cytosine…

Q: What does tRNA stand for?

A: The central dogma is the theory explaining the process of gene expression that initiates from the…

Q: Define aminoacyl tRNA synthetase

A: Nucleic acids are biological macromolecules that are essential to all known forms of life as they…

Q: What are the sequences of all the possibletripeptides that contain the amino acids aspartic acid,…

A: Amino acids are the building blocks of proteins. They contain amino group, carboxyl group, and…

Q: Define amino acid replacement

A: A mutation is a change that occurs in DNA or protein sequence, either due to mistakes during cell…

Q: Identify if the statement is correct or incorrect, "rRNA serves as template for the synthesis of…

A: During translation, protein is formed. A segment of DNA carries the code required for specific…

Q: Hello , please help me with this question. I am struggling with naming the Amino Acid sequence from…

A: Codon is the triplet of either DNA or RNA nucleotides which codes for a specific amino acid during…

Q: ______________ Proteins Function in Several Quality-Control Steps of Translation.

A: Translation is one of the important processes that take place in the central dogma. The proteins are…

Q: Translation Is Terminated by _______ ________ when a Stop Codon Is Reached.

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: How many possible nucleotide sequences could code for a peptide with the sequence "MRRTGERS*"? (Note…

A: The given sequence is 'MRRTGERS*'. The amino acid sequence is…

Q: An amino acid is added to the CCA terminus of the tRNA molecule. true or false

A: True, An amino acid is added to the CCA terminus of the tRNA molecule. The CCA terminal of tRNA is…

Q: TRNAS do vary in length. True False

A: RNA is ribonucleic acid which is formed from DNA .It is further of three types :- A )rRNA (…

Q: TRUE OR FALSE: tRNA-met complexes with mRNA at the aminoacyl-site of the ribosome

A: Introduction  The process of decoding the genetic code contained within a messenger RNA (mRNA)…

Q: How do you translate this into amino acid sequence

A: The process of synthesis of protein with the help of messenger RNA is called translation. In the…

Q: figured out that the protein sequence was:   Met-Ala-Arg-Gly-Trp-Ala-Pro   Work backwards…

A: In this process first of all RNA sequence could be find out by the genetic code. Later on  sequences…

Q: The amino acid hydroxyproline is found in collagen. There is no codon for hydroxyproline. Explain…

A: Post-translational modification refers to the covalent and enzymatic modification of proteins…

Q: what is the correct way of drawing a peptide backbone?

A: A peptide is a polymer of amino acids. In a peptide, 2 amino acids are linked to each other via a…

Q: Describe the charging process of a tRNA.

A: A form of RNA molecule known as tRNA aids in the translation of a mRNA into a specific protein.…

Q: Create protein sequence with 10 amino acids

A: A protein is a polymer of amino acids.  Two amino acids are joined together by forming a peptide…

Q: Second letter C UUU Phe UCU) UCC UGU UAU1 Tyr UAC S U UUC U UUA L UUG J Ser UGCCYS UAA Stop UGA Stop…

A: tRNA is an amino acid acceptor which carries the amino acid corresponding to the code present in the…

Q: What amino acid would a tRNA with anticodon CUA carry? Enter the 3 letter code only [A]. [e.g. Met…

A: tRNA stands for the transfer RNA and it has L- shaped structure . Transfer RNA acts as an adopter…

Q: how many letters of rna molecules in squence does it take to provide the code for a single amino…

A: RNA is involved in the synthesis of protein and this is carried out through a process called…

Q: Suppose that there is a protein consisting of two polypeptide chains with the given sequences in the…

A: Edman degradation, which was invented by Pehr Edman, can be used to determine the amino acid…

Q: Describe charging of tRNA or aminoacylation of tRNA.

A: Transfer RNA or tRNA is a special type of RNA, which is useful in decoding the sequence of messenger…

Q: What would be the tRNA anticodons for the mRNA in question 3

A: Answer- ATGGATCT CGA- UACCUAGA GCT will be the following anti-codons .

Q: pH @1 of Cys-His-Glu-Met-Ile-Ser-Thr-Arg-Tyr

A: Peptides are organic compounds made up of amino acids connected by peptide bonds. The specific…

Q: Drew the peptide sequence and write its full name Cys-Gln-Lys-His-Ala-Ser-Gln

A: All the amino acids mentioned in the question are linked Together by peptide bonds that is CONH. A…

Q: bonds between the nitrogenous bases hold the two single strands together in the double in the double…

A: DNA is the major hereditary material in Eukaryotic organisms. J.D.Watson and F.H.C. Crick (1953)…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.