Write the mRNA sequence (5′ to 3′) that would result from transcription of the DNA sequence. (Note: Ignore the colors) **DNA Sequence Overview:**This image represents a segment of a DNA sequence displayed from the 5' end to the 3' end. The sequence is:```5' CTATAAGGCGCAAATCCCTGCCAT 3'```**Highlighted Nucleotides:**The sequence features specific nucleotides that are highlighted and numbered with arrows:1. **Blue Arrow (1)**: Points to the nucleotide "C".2. **Red Arrow (2)**: Points to the nucleotide "C".3. **Purple Arrow (3)**: Points to the nucleotide "G".4. **Green Arrow (4)**: Points to the nucleotide "G".These colored arrows may represent significant points of interest in the DNA sequence, such as mutation sites, binding sites, or other relevant genetic markers. Each color is paired with a corresponding number reference for clarity. This image represents the genetic code chart, which illustrates the relationship between codons and amino acids. Codons are sequences of three nucleotides, and the chart is organized by the first, second, and third positions of these nucleotide sequences, labeled as First Base, Second Base, and Third Base, respectively.### First Base: - **U:** - UUU, UUC -> Phenylalanine (F) - UUA, UUG -> Leucine (L)- **C:** - CUU, CUC, CUA, CUG -> Leucine (L) - CCU, CCC, CCA, CCG -> Proline (P)- **A:** - AUU, AUC, AUA -> Isoleucine (I) - AUG -> Methionine (M, start codon) - ACU, ACC, ACA, ACG -> Threonine (T)- **G:** - GUU, GUC, GUA, GUG -> Valine (V) - GCU, GCC, GCA, GCG -> Alanine (A)### Second Base:- **U:** - UAU, UAC -> Tyrosine (Y) - UAA, UAG -> Stop codons - UGU, UGC -> Cysteine (C) - UGA -> Stop codon - UGG -> Tryptophan (W)- **C:** - CAU, CAC -> Histidine (H) - CAA, CAG -> Glutamate (Q) - CGU, CGC, CGA, CGG -> Arginine (R)- **A:** - AAU, AAC -> Asparagine (N) - AAA, AAG -> Lysine (K)- **G:** - GAU, GAC -> Aspartic acid (D) - GAA, GAG -> Glutamic acid (E) - GGU, GGC, GGA, GGG -> Glycine (G)### Third Base:Columns represent the variable third base, allowing determination of specific amino acid coding.This chart is a critical tool in understanding protein synthesis, showing how various sequences of nucleotides direct the assembly of amino acids, creating proteins necessary for life processes. Each amino

Deoxyribonucleic acid or DNA is the type of nucleic acid present in the nucleus of the cell. It is the genetic material that transfers from one generation to another. It is made up of nucleotides. The biological information stored in DNA flows to RNA and then from RNA to proteins. This is the central dogma of life. Fig. The central dogma of lifeRNA is also a nucleic acid that helps in the synthesis of protein. Transcription is a process by which DNA transcript into RNA (especially mRNA). RNA contains uracil instead of thymine. The main strand of DNA: 5'-CTATAAGGCGCAAATCCCTGCCAT-3' The complementary strand of DNA: 3'-GATATTCCGCGTTTAGGGACGGTA-5' Transcription: 5'-CUAUAAGGCGCAAAUCCCUGCCAU-3'

Answered: Write the mRNA sequence (5′ to 3′) that…

Science

Biochemistry

Write the mRNA sequence (5′ to 3′) that would result from transcription of the DNA sequence. (Note: Ignore the colors)

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

Give the coordinate for the last base of the first exon for tra-RB; type a number as in 7,000 (include the comma)
When the sequence CpG occurs, the cytosine can be methylated. If a methylated cytosine is then deaminated, it will be mutated to ["adenine", "thymine", "uracil", "guanine"] . As a result, CpG sequences are underrepresented in the genome. The presence of a CpG island at a particular location suggests that the location might be a(n) ["exon", "promoter", "enhancer", "intron", "telomere"] . Pick answers within quotation marks to fill in the blanks.
Translate to amino acids the strand using the Genetic Code chart. Remember to use the start and stop sequences. UGCGAUGGCAAUCGGUGUACCCCUGACUGAGC
A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. MMutant 4: Met-Ser-Pro-Glu-Gl
Sickle cell anemia is a widespread disease in many African countries and can be caused by a change in the amino acid sequence from glutamic acid to valine. A patient is diagnosed with the disease and a genetic fingerprint reveals the following DNA sequence for the gene: (a) (b) (c) (d) (e) Write down the mRNA sequence for the given DNA sense strand indicating the polarity. Derive the polypeptide from the mRNA molecule using the table of the genetic code (Table Q1 below) again indicating the polarity of the peptide chain. Indicate the position in the DNA molecule that could have caused the disease and write down all possible point mutations in the DNA sequence that could have caused it. [ The polypeptide chain is polymerized at the ribosomes using t-RNA molecules. Write down all possible t-RNA molecules with their anti-codons that are used to polymerize the amino acid VAL. Indicate the polarity. 3'-TAC TGA GCA AGA TTA CAT ACT-5' Explain what is meant by redundancy of the genetic code.…
For the following sequence please design an 18 base pair forward primer. ATGGCTGATAAGATAGAGAGGCATACTTTCAAGGTCTTCAATCAAGATTTCGAAAAAGAGCTGGAGTTTGGATTAGATAGAAAATATTTTTAG
Consider the following mRNA sequence: 5'-UUG ACC GAC-3'. Note: Reference the Genetic code table for additional information. Part: 0 / 5 Part 1 of 5 What amino acid sequence is coded for by this mRNA? ☑
For each of the following sequences, rank them in order (from best to worst) as sequences that could be used to initiate translation according to Kozak’s rules. GACGCCAUGG GCCUCCAUGC GCCAUCAAGG GCCACCAUGG
Below is the DNA sequence of a gene, what is the protein sequence? 5'-GGTAAGCTAGCTATGACTACCCTGACATAGATATCGACTAGCTG-3' Insert the amino acid sequence using the single letter designation for the amino acid (ex: use ACG instead of AlaCysGly). Include only the letters in the correct order as they would be translated using no commas, no spaces and no dashes.
Use the first photo to answer the following questions.
In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Note, the answer blanks for mRNA may appear vertically on some displays. In this case, enter the bases from top to bottom. Then, for each set of three DNA and complementary mRNA nucleotides, use the amino acid chart to translate the nucleotides into amino acids, and type them below. Enter the full, unabbreviated name of the amino acid in the blank provided. In the case of a stop codon, enter "Stop"
The E. coli DNA molecule contains 4.70 x 105 base pairs. Determine the number of codons that can be present in this DNA molecule. number of codons: 1.57 x106 codons Assuming that the average protein in E. coli consists of a chain of 420 amino acids, calculate the maximum number of proteins that can be coded by an E. coli DNA molecule. number of proteins: proteins