Please answer all parts of the question First base in codonThe following non-coding sequence (i.e. template strand) is transcribed by the RNA pol II intoa pre-mRNA.5'-CTAACTGCTATGCAT-3'a) Determine the mRNA synthesized by the RNA pol II.You have to write the sequence from the 5' end to the 3' end and indicate those ends as shownin the original sequence.b) Using the genetic code provided below, determine the amino acid sequence if the mRNAdetermined in part a) were translated.You have to write the amino acid sequence from the N-terminus end to the C-terminus end andindicate those at each and in parentheses. For example: (N)-.......-(C)A mutation occurred in the nucleotide sequence, and the new non-coding sequence is shownbelow: 5'-CTAACTGCTAGTGCAT-3'c) Indicate the specific mutation that occurred in the non-coding strand and its type.d) What consequence will the mutation have on the polypeptide chain? Justify your answerand write the new polypeptide sequence if it has changed as a result of this mutation.You have to write the amino acid sequence from the N-terminus end to the C-terminus end andindicate those at each and in parentheses. For example: (N)-.......-(C)UCAGUUUUUC-UUAUUGUUCUUCCUCAUCGCUUCCUCUCCCCCUACCACUGCCGAUUACUAUC Ile (1)ACCAUAACAAUG Met (M) start ACG-GUU-GCUGUCGCCGUAGCAGUG-GCGPhe (F)Leu (L)Leu (L)Second base in codonVal (V)сSer (S)Pro (P)Thr (T)Ala (A)UAUUAC-UAAUAGCAUCACCAA 1CAGAAUAACAAA 1AAGAGAUGACGAA 1GAGTyr (Y)STOPHis (H)Gin (Q)Asn (N)Lys (K)Asp (D)Glu (E)GUGUUGCUGA STOPUGG Trp (W)CGUCGCCGACGGAGUAGCAGAAGGGGUGGCGGAGGGCys (C)Arg (R)Ser (S)Arg (R)Gly (G)UCAGUCAGDUAGUAGCCАLast basecodon

Name: Please answer all parts of the question First base in codonThe followi
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Please answer all parts of the question First base in codonThe following non-coding sequence (i.e. template strand) is transcribed by the RNA pol II intoa pre-mRNA.5'-CTAACTGCTATGCAT-3'a) Determine the mRNA synthesized by the RNA pol II.You have to w