Discuss the following statement: “from the nucleotide sequence of a cDNA clone, the complete amino acid sequence of a protein can be deduced by applying the genetic code. thus, protein biochemistry has become superfluous because there is nothing more that can be learned by studying the protein.”

Q: Consider Molecule X, which is found in all living cells. This molecule is transcribed from a stretch…

A: DNA is a biomolecule present in the eukaryotic nucleus. It is made up of nucleotides.

Q: The two-dimensional structures of mRNA, tRNA, and rRNA are shown in the diagrams. Which of the…

A: The primary function of rRNA is the synthesis of proteins by binding to mRNA and tRNA to ensure the…

Q: Which of the following types of enzymes is primarily responsible for setting up the genetic code?…

A: Enzymes are the biocatalyst ,which increases the rate of chemical reactions in the body.Most of the…

Q: Consider the following DNA sequence: CATGTGTAGTCTAAA. Address the followin questions: AWrite the…

A: In DNA,the genes are present.From these genes mRNA is formed by transcription. This mRNA undergoes…

Q: What is meant by the term cDNA, and how may a cDNA differ from the gene from which it is derived?…

A: DNA, or deoxyribonucleic acid, is the hereditary material in humans and almost all other animals.…

Q: Explain point  mutations and frameshift mutations. Which is more apt to disrupt the  structure and…

A: Proteins are the expression of the information present in the DNA (deoxyribonucleic acid). This…

Q: A DNA strand consists of any sequence of four kinds of nucleotides. Suppose there were only 14…

A: Nucleotides are the building blocks of nucleic acids, which are the essential molecules for storing…

Q: Cystic Fibrosis is a genetically heritable disease caused by the loss of the chloride channel, CFTR.…

A: Cystic fibrosis is a genetic disease that is characterized by the production of excessively thick…

Q: Before this experiment, Dr Merrick didn’t know whether the OBP that he cloned was a type of…

A: Proteins can be monomeric or oligomeric. Monomeric proteins have a single subunit (single…

Q: (a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT…

A: Introduction :- Mutations are the hereditary changes that occurs in the Genetic material (DNA) of…

Q: Which statement is false: A) Each type of protein ( ex: hemoglobin vs trypsionngen) varies in the…

A: Gene is a sequence of nucleotides that encode a particular protein. The transcription and…

Q: In diseases such as Creutzfeldt-Jakob disease (CJD), a normal prion protein becomes infectious and…

A: Creutzfeldt-Jakob Disease:  Creutzfeldt-Jakob disease (CJD) is a neurodegenerative disease that…

Q: A 2500 bp region of the human genome encodes two genes. One of the genes encodes a protein of 600…

A: Adenine, Guanine, Thymine and Cytosine are the base pairs which are present in DNA and in RNA Uracil…

Q: The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1)…

A: At first you have to know about coding and non-coding strand. A coding atrand is a DNA strand that…

Q: The following DNA sequence corresponds to the complete coding sequence of a gene that codes for a…

A: mRNA codons are used to determine sequence in the original DNA and anticodons of tRNA.  tRNA…

Q: The figure below shows the introns and exons found in gene X. The size of each exon and intron is…

A: In genes  there are two type of sequence in eukaryotic organisms. one is responsible for formation…

Q: between gene and protein was first articulated by Beadle & Tatum, who proposed the one-gene,…

A: The one gene–one enzyme theory proposes that genes work by making enzymes, with each gene producing…

Q: Beadle and Tatum's experiments led to the "one gene - one enzyme (protein)" hypothesis. In…

A: The genes are the functional part of the DNA that are responsible for the production of RNA by the…

Q: Which of the following is a reason why codons are NOT composed of only two nucleotides? Question 22…

A: The biochemical substance that is carried forward from the preceding generation to the succeeding…

Q: WVA1 is a protein that is secreted by epithelial tissues of mice. Which of the following is not…

A: The genetic information is stored in the DNA sequence of the gene. This data is transcribed into a…

Q: a. Identify the sequence that was mutated by the scientists and explain your reasoning. b. What…

A: Ans) a)A mutant protein is the protein product encoded by a gene with mutation. Mutated protein can…

Q: Human wildtype and mutant alleles are identical in sequence except for a single base-pair…

A: A mutation is any change in the DNA sequence of a cell. It may alter one or a few base pairs or…

Q: Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which…

A: CF is caused by a mutation in a gene called the cystic fibrosis transmembrane conductance regulator…

Q: You’re working in Marshall Nirenberg’s lab, trying to decipher the genetic code. You use several…

A: Marshall Nirenberg studied the genetic codes for protein synthesis in his biochemical research. He…

Q: If the codon AAA is mutated to AAG, it still codes for the amino acid, lysine, and the protein…

A: Mutations are the changes in the genes of the cell that causes abnormalities in the structure and…