An example sequence corresponds to human sickle cell beta-globin mRNA and that this disease results from a point mutation in the β globin gene. In the following section, you will compare sickle cell and normal β globin sequences to reveal the nature of the sickle cell mutation at the protein level. To do this you need to find atleast one sequence representing the normal beta globin gene. Open a new window and visit the NCBI home page(http://www.ncbi.nlm.nih.gov) and select “Nucleotide” from the drop menu associated with the top search box. Then enter the search term: HBB . Note that lots of irrelevant results are returned so let's apply some “Filters” (available by clicking in the left-hand sidebar) to focus on RefSeq entries for Homo sapiens. Remember that we are after mRNA so we can compare to the mRNA sequence from part 1 above.QUESTION #1: What is the ACCESSION number of the “Homo sapiens hemoglobin, beta (HBB), mRNA” entry? NOTE: Boolean operators (NOT, AND, OR) as well as fielded queries (i.e. “HBB[Gene Name] AND Human[Organism]” ) can be used in ENTREZ searches to filter results for more efficient searching. Select “Homo sapiens hemoglobin, beta (HBB), mRNA” from the results and scroll down to the FEATURES section toanswer the following.QUESTION #2: What are the numbers of the first and last base positions of exon 1 of this entry? (HINT: You can also find this by selecting the “GRAPHICS” display and placing your mouse over the first exon (see Figure). Introduction:This lab activity aims to present the different bioinformatics databases andrelated services accessible on the internet and investigate the molecular basis of acommon human disease. Part 1 and 2 utilizes searching in the GenBank, GENE andOMIM databases at NCBI.Side-note: The Web is a dynamic environment, where information is constantly addedand removed. Servers "go down", links change without warning, etc. This can lead to"broken" links and results not being returned from services. Don't give up - give it asecond go and try a search engine using terms related to the page you are trying toaccess.Objective:1. Familiarize yourself with various bioinformatics databases in the web2. Manipulate GenBank, GENE and OMIM at NCBI.Materials:Bioinformatics databasesProcedure:Part 1The following transcript was found to be abundant in a human patient's blood sample.>example1ATGGTGCATCTGACTCCTGTGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCAGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTAAGCTCGCTTTCTTGCTGTCCAATTTThe only information you are given is the above sequence so you must begin yourinvestigation with a sequence search - for this example we will use NCBI's BLASTservice at: http://blast.ncbi.nlm.nih.gov/Note that there are several different "basic BLAST" programs available at NCBI(Including nucleotide BLAST, protein BLAST, and BLASTX).

Name: An example sequence corresponds to human sickle cell beta-globin mRNA
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: An example sequence corresponds to human sickle cell beta-globin mRNA and that this disease results from a point mutation in the β globin gene. In the following section, you will compare sickle cell and normal β globin sequences to reveal the nature

Answered: An example sequence corresponds to…

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Related questions

Concept explainers

Topic Video

Question

An example sequence corresponds to human sickle cell beta-globin mRNA and that this disease results from a point mutation in the β globin gene. In the following section, you will compare sickle cell and normal β globin sequences to reveal the nature of the sickle cell mutation at the protein level. To do this you need to find at

least one sequence representing the normal beta globin gene. Open a new window and visit the NCBI home page
(http://www.ncbi.nlm.nih.gov) and select “Nucleotide” from the drop menu associated with the top search box. Then enter the search term: HBB . Note that lots of irrelevant results are returned so let's apply some “Filters” (available by clicking in the left-hand sidebar) to focus on RefSeq entries for Homo sapiens. Remember that we are after mRNA so we can compare to the mRNA sequence from part 1 above.

QUESTION #1:

What is the ACCESSION number of the “Homo sapiens hemoglobin, beta (HBB), mRNA” entry?

NOTE: Boolean operators (NOT, AND, OR) as well as fielded queries (i.e. “HBB[Gene Name] AND Human[Organism]” ) can be used in ENTREZ searches to filter results for more efficient searching. Select “Homo sapiens hemoglobin, beta (HBB), mRNA” from the results and scroll down to the FEATURES section to
answer the following.

QUESTION #2:

What are the numbers of the first and last base positions of exon 1 of this entry? (HINT: You can also find this by selecting the “GRAPHICS” display and placing your mouse over the first exon (see Figure).

Introduction:
This lab activity aims to present the different bioinformatics databases and
related services accessible on the internet and investigate the molecular basis of a
common human disease. Part 1 and 2 utilizes searching in the GenBank, GENE and
OMIM databases at NCBI.
Side-note: The Web is a dynamic environment, where information is constantly added
and removed. Servers "go down", links change without warning, etc. This can lead to
"broken" links and results not being returned from services. Don't give up - give it a
second go and try a search engine using terms related to the page you are trying to
access.
Objective:
1. Familiarize yourself with various bioinformatics databases in the web
2. Manipulate GenBank, GENE and OMIM at NCBI.
Materials:
Bioinformatics databases
Procedure:
Part 1
The following transcript was found to be abundant in a human patient's blood sample.
>example1
ATGGTGCATCTGACTCCTGTGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAG
TTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGG
GGATCTGTCCACTCCTGATGCAGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGT
GCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACT
GTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCA
TCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAAT
GCCCTGGCCCACAAGTATCACTAAGCTCGCTTTCTTGCTGTCCAATTT
The only information you are given is the above sequence so you must begin your
investigation with a sequence search - for this example we will use NCBI's BLAST
service at: http://blast.ncbi.nlm.nih.gov/
Note that there are several different "basic BLAST" programs available at NCBI
(Including nucleotide BLAST, protein BLAST, and BLASTX).

Expert Solution

Trending now

This is a popular solution!

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.