Eukaryotic mRNA: usessnRNPs to cut out introns and seal together translatableexons. uses a spliceosome mechanism made of DNA to recognizeconsensus sequences to cut and splice. has a guanine cap on its 39 end and a poly(A) tail on its 59 end. is composed of adenine, thymine, guanine, and cytosine. codes the guanine cap and poly(A) tail from the DNAtemplate.

Question

Want to see more full solutions like this?

Answer 1

Textbook Question

Chapter 15, Problem 1TYK

Eukaryotic mRNA:

usessnRNPs to cut out introns and seal together translatableexons.

uses a spliceosome mechanism made of DNA to recognizeconsensus sequences to cut and splice.

has a guanine cap on its 39 end and a poly(A) tail on its 59 end.

is composed of adenine, thymine, guanine, and cytosine.

codes the guanine cap and poly(A) tail from the DNAtemplate.

Expert Solution & Answer

Summary Introduction

Introduction:

The messenger ribonucleic acid (mRNA) is that type of RNA that transcripts the DNA (deoxyribonucleic acid). RNA polymerase synthesizes a precursor of mRNA (pre-mRNA) in eukaryotes, which is then processed to form mRNA that is in a translatable form. The mRNA attaches to the ribosome where the amino acids bind to form polypeptide chains.

Answer to Problem 1TYK

Correct answer:

The eukaryotic mRNA uses snRNPs to cut out introns and seal together the translatable exons.

Explanation of Solution

Justification for the correct answer:

Option (a) states that the eukaryotic mRNA uses snRNPs to cut out introns and seal together translatable exons. The snRNPs (small nuclear ribonucleoprotein particles) bind to the pre-mRNA to form a complex spliceosome. The spliceosome breaks the pre-mRNA to remove nonprotein coding RNA sequences called introns and joins the coding RNA sequences named exons that can be translated. Hence, option (a) is correct.

Justification for the incorrect answers:

Option (b) states that eukaryotic mRNA uses a spliceosome mechanism made up of the DNA to recognize the consensus sequences to cut and splice. The spliceosome is a complex sequence formed by pre-mRNA and small nuclear ribonucleoprotein particles (snRNPs). The spliceosome breaks the pre-mRNA to remove the nonprotein coding sequences called introns. So, it is an incorrect option.

Option (c) states that the eukaryotic mRNA has a guanine cap on its 3′-end and the poly (A) tail on its 5′-end. The pre-mRNA process includes a capping enzyme that adds a cap at the 5′-end and at the 3′-end. The enzyme poly (A) polymerase adds a chain of adenine nucleotides at the 3′-end and 7-methylguanosine cap is added to the 5′-end of pre-mRNA. Thus, it is an incorrect option.

Option (d) states that the eukaryotic mRNA is composed of adenine, thymine, guanine, and cytosine. In the mRNA, there is uracil in the place of thymine. Both of these are pyrimidines that attach to adenine. So, it is an incorrect option.

Option (e) states that the eukaryotic mRNA codes the guanine cap and the poly (A) tail from the DNA template. This is incorrect because the guanine cap and the poly (A) tail in mRNA is not coded from the DNA template. A capping enzyme adds a cap at the 5′-end and at the 3′-end. The enzyme poly (A) polymerase adds a chain of adenine nucleotides, which makes the poly (A) tail of mRNA. So, it is an incorrect option.

Hence, options, (b), (c), (d), and (e) are incorrect.

Conclusion

Thus, it can be concluded that in the eukaryotes, small nuclear ribonucleoprotein particles (snRNPs) bind to the pre-mRNA to form a complex spliceosome. The spliceosome breaks the pre-mRNA to remove the nonprotein coding sequences called introns and joins the coding RNA sequences called exons, which can be translated.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Students have asked these similar questions

A segment of mRNA produced by the normal order of DNA nucleotides and the corresponding amino acid chain are given below: mRNA segment: GCC UAC AAU GCG Amino acid chain: Ala-Tyr-Asn-Ala Knowing that insertion mutations shift the triplets by one base, if an insertion mutation adds a U to the beginning of that mRNA segment, what will be the new triplet/codon grouping and the new amino acid chain? Group of answer choices a. U GCC UAC AAU GCG; Ala-Tyr-Asn-Ala b. UCC UAC AAU GCG; Ser-Leu-Gln-Cys c. UGC CUA CAA UGC G; Cys-Leu-Gln-Cys d. UGC CUA CAA UGC G; Ala-Tyr-Asn-Ala e. UGCC UAC AAU GCG; Cys-Tyr-Asn-Ala

At least three types of RNA are required for protein synthesis. Compare and contrast mRNA, rRNA, and tRNA by moving the descriptions of their structure and function to the appropriate categories. Some phrases may describe all three types of RNA. mRNA in eukaryotes, can exist outside the nucleus acts as an enzyme for peptide synthesis composed of ribonucleic acid rRNA Answer Bank moves amino acids to the site of protein synthesis tRNA contains nucleotide triplets that code for specific amino acids has a convoluted structure with a three-base sequence called an anticodon moves genetic information out of the nucleus and into the cytoplasm mRNA, rRNA, and tRNA

The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1) Find the sequence of the MRNA that would be made from this gene. 2) Find the amino acid protein sequence that would be made from this gene 3) A mutation occurs at position 17 of the coding DNA strand, where the Tis substituted with A (count from 5' end of coding strand). Write the resulting mRNA and protein sequences. Show all your work!

Answer 2

Textbook Question

Chapter 15, Problem 1TYK

Eukaryotic mRNA:

usessnRNPs to cut out introns and seal together translatableexons.

uses a spliceosome mechanism made of DNA to recognizeconsensus sequences to cut and splice.

has a guanine cap on its 39 end and a poly(A) tail on its 59 end.

is composed of adenine, thymine, guanine, and cytosine.

codes the guanine cap and poly(A) tail from the DNAtemplate.

Expert Solution & Answer

Summary Introduction

Introduction:

The messenger ribonucleic acid (mRNA) is that type of RNA that transcripts the DNA (deoxyribonucleic acid). RNA polymerase synthesizes a precursor of mRNA (pre-mRNA) in eukaryotes, which is then processed to form mRNA that is in a translatable form. The mRNA attaches to the ribosome where the amino acids bind to form polypeptide chains.

Answer to Problem 1TYK

Correct answer:

The eukaryotic mRNA uses snRNPs to cut out introns and seal together the translatable exons.

Explanation of Solution

Justification for the correct answer:

Option (a) states that the eukaryotic mRNA uses snRNPs to cut out introns and seal together translatable exons. The snRNPs (small nuclear ribonucleoprotein particles) bind to the pre-mRNA to form a complex spliceosome. The spliceosome breaks the pre-mRNA to remove nonprotein coding RNA sequences called introns and joins the coding RNA sequences named exons that can be translated. Hence, option (a) is correct.

Justification for the incorrect answers:

Option (b) states that eukaryotic mRNA uses a spliceosome mechanism made up of the DNA to recognize the consensus sequences to cut and splice. The spliceosome is a complex sequence formed by pre-mRNA and small nuclear ribonucleoprotein particles (snRNPs). The spliceosome breaks the pre-mRNA to remove the nonprotein coding sequences called introns. So, it is an incorrect option.

Option (c) states that the eukaryotic mRNA has a guanine cap on its 3′-end and the poly (A) tail on its 5′-end. The pre-mRNA process includes a capping enzyme that adds a cap at the 5′-end and at the 3′-end. The enzyme poly (A) polymerase adds a chain of adenine nucleotides at the 3′-end and 7-methylguanosine cap is added to the 5′-end of pre-mRNA. Thus, it is an incorrect option.

Option (d) states that the eukaryotic mRNA is composed of adenine, thymine, guanine, and cytosine. In the mRNA, there is uracil in the place of thymine. Both of these are pyrimidines that attach to adenine. So, it is an incorrect option.

Option (e) states that the eukaryotic mRNA codes the guanine cap and the poly (A) tail from the DNA template. This is incorrect because the guanine cap and the poly (A) tail in mRNA is not coded from the DNA template. A capping enzyme adds a cap at the 5′-end and at the 3′-end. The enzyme poly (A) polymerase adds a chain of adenine nucleotides, which makes the poly (A) tail of mRNA. So, it is an incorrect option.

Hence, options, (b), (c), (d), and (e) are incorrect.

Conclusion

Thus, it can be concluded that in the eukaryotes, small nuclear ribonucleoprotein particles (snRNPs) bind to the pre-mRNA to form a complex spliceosome. The spliceosome breaks the pre-mRNA to remove the nonprotein coding sequences called introns and joins the coding RNA sequences called exons, which can be translated.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 3

Textbook Question

Chapter 15, Problem 1TYK

Eukaryotic mRNA:

usessnRNPs to cut out introns and seal together translatableexons.

uses a spliceosome mechanism made of DNA to recognizeconsensus sequences to cut and splice.

has a guanine cap on its 39 end and a poly(A) tail on its 59 end.

is composed of adenine, thymine, guanine, and cytosine.

codes the guanine cap and poly(A) tail from the DNAtemplate.

Expert Solution & Answer

Summary Introduction

Introduction:

The messenger ribonucleic acid (mRNA) is that type of RNA that transcripts the DNA (deoxyribonucleic acid). RNA polymerase synthesizes a precursor of mRNA (pre-mRNA) in eukaryotes, which is then processed to form mRNA that is in a translatable form. The mRNA attaches to the ribosome where the amino acids bind to form polypeptide chains.

Answer to Problem 1TYK

Correct answer:

The eukaryotic mRNA uses snRNPs to cut out introns and seal together the translatable exons.

Explanation of Solution

Justification for the correct answer:

Option (a) states that the eukaryotic mRNA uses snRNPs to cut out introns and seal together translatable exons. The snRNPs (small nuclear ribonucleoprotein particles) bind to the pre-mRNA to form a complex spliceosome. The spliceosome breaks the pre-mRNA to remove nonprotein coding RNA sequences called introns and joins the coding RNA sequences named exons that can be translated. Hence, option (a) is correct.

Justification for the incorrect answers:

Option (b) states that eukaryotic mRNA uses a spliceosome mechanism made up of the DNA to recognize the consensus sequences to cut and splice. The spliceosome is a complex sequence formed by pre-mRNA and small nuclear ribonucleoprotein particles (snRNPs). The spliceosome breaks the pre-mRNA to remove the nonprotein coding sequences called introns. So, it is an incorrect option.

Option (c) states that the eukaryotic mRNA has a guanine cap on its 3′-end and the poly (A) tail on its 5′-end. The pre-mRNA process includes a capping enzyme that adds a cap at the 5′-end and at the 3′-end. The enzyme poly (A) polymerase adds a chain of adenine nucleotides at the 3′-end and 7-methylguanosine cap is added to the 5′-end of pre-mRNA. Thus, it is an incorrect option.

Option (d) states that the eukaryotic mRNA is composed of adenine, thymine, guanine, and cytosine. In the mRNA, there is uracil in the place of thymine. Both of these are pyrimidines that attach to adenine. So, it is an incorrect option.

Option (e) states that the eukaryotic mRNA codes the guanine cap and the poly (A) tail from the DNA template. This is incorrect because the guanine cap and the poly (A) tail in mRNA is not coded from the DNA template. A capping enzyme adds a cap at the 5′-end and at the 3′-end. The enzyme poly (A) polymerase adds a chain of adenine nucleotides, which makes the poly (A) tail of mRNA. So, it is an incorrect option.

Hence, options, (b), (c), (d), and (e) are incorrect.

Conclusion

Thus, it can be concluded that in the eukaryotes, small nuclear ribonucleoprotein particles (snRNPs) bind to the pre-mRNA to form a complex spliceosome. The spliceosome breaks the pre-mRNA to remove the nonprotein coding sequences called introns and joins the coding RNA sequences called exons, which can be translated.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 4

Textbook Question

Chapter 15, Problem 1TYK

Eukaryotic mRNA:

usessnRNPs to cut out introns and seal together translatableexons.

uses a spliceosome mechanism made of DNA to recognizeconsensus sequences to cut and splice.

has a guanine cap on its 39 end and a poly(A) tail on its 59 end.

is composed of adenine, thymine, guanine, and cytosine.

codes the guanine cap and poly(A) tail from the DNAtemplate.

Expert Solution & Answer

Summary Introduction

Introduction:

The messenger ribonucleic acid (mRNA) is that type of RNA that transcripts the DNA (deoxyribonucleic acid). RNA polymerase synthesizes a precursor of mRNA (pre-mRNA) in eukaryotes, which is then processed to form mRNA that is in a translatable form. The mRNA attaches to the ribosome where the amino acids bind to form polypeptide chains.

Answer to Problem 1TYK

Correct answer:

The eukaryotic mRNA uses snRNPs to cut out introns and seal together the translatable exons.

Explanation of Solution

Justification for the correct answer:

Option (a) states that the eukaryotic mRNA uses snRNPs to cut out introns and seal together translatable exons. The snRNPs (small nuclear ribonucleoprotein particles) bind to the pre-mRNA to form a complex spliceosome. The spliceosome breaks the pre-mRNA to remove nonprotein coding RNA sequences called introns and joins the coding RNA sequences named exons that can be translated. Hence, option (a) is correct.

Justification for the incorrect answers:

Option (b) states that eukaryotic mRNA uses a spliceosome mechanism made up of the DNA to recognize the consensus sequences to cut and splice. The spliceosome is a complex sequence formed by pre-mRNA and small nuclear ribonucleoprotein particles (snRNPs). The spliceosome breaks the pre-mRNA to remove the nonprotein coding sequences called introns. So, it is an incorrect option.

Option (c) states that the eukaryotic mRNA has a guanine cap on its 3′-end and the poly (A) tail on its 5′-end. The pre-mRNA process includes a capping enzyme that adds a cap at the 5′-end and at the 3′-end. The enzyme poly (A) polymerase adds a chain of adenine nucleotides at the 3′-end and 7-methylguanosine cap is added to the 5′-end of pre-mRNA. Thus, it is an incorrect option.

Option (d) states that the eukaryotic mRNA is composed of adenine, thymine, guanine, and cytosine. In the mRNA, there is uracil in the place of thymine. Both of these are pyrimidines that attach to adenine. So, it is an incorrect option.

Option (e) states that the eukaryotic mRNA codes the guanine cap and the poly (A) tail from the DNA template. This is incorrect because the guanine cap and the poly (A) tail in mRNA is not coded from the DNA template. A capping enzyme adds a cap at the 5′-end and at the 3′-end. The enzyme poly (A) polymerase adds a chain of adenine nucleotides, which makes the poly (A) tail of mRNA. So, it is an incorrect option.

Hence, options, (b), (c), (d), and (e) are incorrect.

Conclusion

Thus, it can be concluded that in the eukaryotes, small nuclear ribonucleoprotein particles (snRNPs) bind to the pre-mRNA to form a complex spliceosome. The spliceosome breaks the pre-mRNA to remove the nonprotein coding sequences called introns and joins the coding RNA sequences called exons, which can be translated.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 5

Textbook Question

Answer 6

Textbook Question

Answer 7

Expert Solution & Answer

Summary Introduction

Introduction:

The messenger ribonucleic acid (mRNA) is that type of RNA that transcripts the DNA (deoxyribonucleic acid). RNA polymerase synthesizes a precursor of mRNA (pre-mRNA) in eukaryotes, which is then processed to form mRNA that is in a translatable form. The mRNA attaches to the ribosome where the amino acids bind to form polypeptide chains.

Answer to Problem 1TYK

Correct answer:

The eukaryotic mRNA uses snRNPs to cut out introns and seal together the translatable exons.

Explanation of Solution

Justification for the correct answer:

Option (a) states that the eukaryotic mRNA uses snRNPs to cut out introns and seal together translatable exons. The snRNPs (small nuclear ribonucleoprotein particles) bind to the pre-mRNA to form a complex spliceosome. The spliceosome breaks the pre-mRNA to remove nonprotein coding RNA sequences called introns and joins the coding RNA sequences named exons that can be translated. Hence, option (a) is correct.

Justification for the incorrect answers:

Option (b) states that eukaryotic mRNA uses a spliceosome mechanism made up of the DNA to recognize the consensus sequences to cut and splice. The spliceosome is a complex sequence formed by pre-mRNA and small nuclear ribonucleoprotein particles (snRNPs). The spliceosome breaks the pre-mRNA to remove the nonprotein coding sequences called introns. So, it is an incorrect option.

Option (c) states that the eukaryotic mRNA has a guanine cap on its 3′-end and the poly (A) tail on its 5′-end. The pre-mRNA process includes a capping enzyme that adds a cap at the 5′-end and at the 3′-end. The enzyme poly (A) polymerase adds a chain of adenine nucleotides at the 3′-end and 7-methylguanosine cap is added to the 5′-end of pre-mRNA. Thus, it is an incorrect option.

Option (d) states that the eukaryotic mRNA is composed of adenine, thymine, guanine, and cytosine. In the mRNA, there is uracil in the place of thymine. Both of these are pyrimidines that attach to adenine. So, it is an incorrect option.

Option (e) states that the eukaryotic mRNA codes the guanine cap and the poly (A) tail from the DNA template. This is incorrect because the guanine cap and the poly (A) tail in mRNA is not coded from the DNA template. A capping enzyme adds a cap at the 5′-end and at the 3′-end. The enzyme poly (A) polymerase adds a chain of adenine nucleotides, which makes the poly (A) tail of mRNA. So, it is an incorrect option.

Hence, options, (b), (c), (d), and (e) are incorrect.

Conclusion

Thus, it can be concluded that in the eukaryotes, small nuclear ribonucleoprotein particles (snRNPs) bind to the pre-mRNA to form a complex spliceosome. The spliceosome breaks the pre-mRNA to remove the nonprotein coding sequences called introns and joins the coding RNA sequences called exons, which can be translated.

Answer 8

Expert Solution & Answer

Summary Introduction

Introduction:

The messenger ribonucleic acid (mRNA) is that type of RNA that transcripts the DNA (deoxyribonucleic acid). RNA polymerase synthesizes a precursor of mRNA (pre-mRNA) in eukaryotes, which is then processed to form mRNA that is in a translatable form. The mRNA attaches to the ribosome where the amino acids bind to form polypeptide chains.

Answer to Problem 1TYK

Correct answer:

The eukaryotic mRNA uses snRNPs to cut out introns and seal together the translatable exons.

Explanation of Solution

Justification for the correct answer:

Option (a) states that the eukaryotic mRNA uses snRNPs to cut out introns and seal together translatable exons. The snRNPs (small nuclear ribonucleoprotein particles) bind to the pre-mRNA to form a complex spliceosome. The spliceosome breaks the pre-mRNA to remove nonprotein coding RNA sequences called introns and joins the coding RNA sequences named exons that can be translated. Hence, option (a) is correct.

Justification for the incorrect answers:

Option (b) states that eukaryotic mRNA uses a spliceosome mechanism made up of the DNA to recognize the consensus sequences to cut and splice. The spliceosome is a complex sequence formed by pre-mRNA and small nuclear ribonucleoprotein particles (snRNPs). The spliceosome breaks the pre-mRNA to remove the nonprotein coding sequences called introns. So, it is an incorrect option.

Option (c) states that the eukaryotic mRNA has a guanine cap on its 3′-end and the poly (A) tail on its 5′-end. The pre-mRNA process includes a capping enzyme that adds a cap at the 5′-end and at the 3′-end. The enzyme poly (A) polymerase adds a chain of adenine nucleotides at the 3′-end and 7-methylguanosine cap is added to the 5′-end of pre-mRNA. Thus, it is an incorrect option.

Option (d) states that the eukaryotic mRNA is composed of adenine, thymine, guanine, and cytosine. In the mRNA, there is uracil in the place of thymine. Both of these are pyrimidines that attach to adenine. So, it is an incorrect option.

Option (e) states that the eukaryotic mRNA codes the guanine cap and the poly (A) tail from the DNA template. This is incorrect because the guanine cap and the poly (A) tail in mRNA is not coded from the DNA template. A capping enzyme adds a cap at the 5′-end and at the 3′-end. The enzyme poly (A) polymerase adds a chain of adenine nucleotides, which makes the poly (A) tail of mRNA. So, it is an incorrect option.

Hence, options, (b), (c), (d), and (e) are incorrect.

Conclusion

Thus, it can be concluded that in the eukaryotes, small nuclear ribonucleoprotein particles (snRNPs) bind to the pre-mRNA to form a complex spliceosome. The spliceosome breaks the pre-mRNA to remove the nonprotein coding sequences called introns and joins the coding RNA sequences called exons, which can be translated.

Answer 9

Expert Solution & Answer

Answer 10

Expert Solution & Answer

Answer 11

Summary Introduction

Introduction:

The messenger ribonucleic acid (mRNA) is that type of RNA that transcripts the DNA (deoxyribonucleic acid). RNA polymerase synthesizes a precursor of mRNA (pre-mRNA) in eukaryotes, which is then processed to form mRNA that is in a translatable form. The mRNA attaches to the ribosome where the amino acids bind to form polypeptide chains.

Answer 12

Answer to Problem 1TYK

Correct answer:

The eukaryotic mRNA uses snRNPs to cut out introns and seal together the translatable exons.

Answer 13

Explanation of Solution

Justification for the correct answer:

Option (a) states that the eukaryotic mRNA uses snRNPs to cut out introns and seal together translatable exons. The snRNPs (small nuclear ribonucleoprotein particles) bind to the pre-mRNA to form a complex spliceosome. The spliceosome breaks the pre-mRNA to remove nonprotein coding RNA sequences called introns and joins the coding RNA sequences named exons that can be translated. Hence, option (a) is correct.

Justification for the incorrect answers:

Option (b) states that eukaryotic mRNA uses a spliceosome mechanism made up of the DNA to recognize the consensus sequences to cut and splice. The spliceosome is a complex sequence formed by pre-mRNA and small nuclear ribonucleoprotein particles (snRNPs). The spliceosome breaks the pre-mRNA to remove the nonprotein coding sequences called introns. So, it is an incorrect option.

Option (c) states that the eukaryotic mRNA has a guanine cap on its 3′-end and the poly (A) tail on its 5′-end. The pre-mRNA process includes a capping enzyme that adds a cap at the 5′-end and at the 3′-end. The enzyme poly (A) polymerase adds a chain of adenine nucleotides at the 3′-end and 7-methylguanosine cap is added to the 5′-end of pre-mRNA. Thus, it is an incorrect option.

Option (d) states that the eukaryotic mRNA is composed of adenine, thymine, guanine, and cytosine. In the mRNA, there is uracil in the place of thymine. Both of these are pyrimidines that attach to adenine. So, it is an incorrect option.

Option (e) states that the eukaryotic mRNA codes the guanine cap and the poly (A) tail from the DNA template. This is incorrect because the guanine cap and the poly (A) tail in mRNA is not coded from the DNA template. A capping enzyme adds a cap at the 5′-end and at the 3′-end. The enzyme poly (A) polymerase adds a chain of adenine nucleotides, which makes the poly (A) tail of mRNA. So, it is an incorrect option.

Hence, options, (b), (c), (d), and (e) are incorrect.

Answer 14

Conclusion

Thus, it can be concluded that in the eukaryotes, small nuclear ribonucleoprotein particles (snRNPs) bind to the pre-mRNA to form a complex spliceosome. The spliceosome breaks the pre-mRNA to remove the nonprotein coding sequences called introns and joins the coding RNA sequences called exons, which can be translated.

Answer 15

Ch. 15.1 - Prob. 1SB Ch. 15.1 - If the codon were five bases long, how many...Ch. 15.2 - For the DNA template below, what would be the...Ch. 15.2 - Prob. 2SB Ch. 15.3 - Prob. 1SB Ch. 15.3 - Prob. 2SB Ch. 15.4 - Prob. 1SB Ch. 15.4 - Distinguish between the P, A, and E sites of the...Ch. 15.4 - Prob. 3SB Ch. 15.5 - How does a missense mutation differ from a silent...

Concept explainers

Videos

Answer to Problem 1TYK

Explanation of Solution

Want to see more full solutions like this?

Chapter 15 Solutions