Biology: The Dynamic Science (MindTap Course List)
4th Edition
ISBN: 9781305389892
Author: Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 15, Problem 1ITD
Summary Introduction
To review:
The amino acids linked by line are specified by codons that differ in a single base. Determine the codons specifying the amino acids shown in the given figure:
Introduction:
The genetic code is a three-letter word or codon that specifies an amino acid. Except for methionine and tryptophan, all amino acids are represented by more than one codon. The first two letters of the codons of an amino acid are identical. These letters indicate the bases present in the
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
A mutation that changes a C to a T causes a type of Ehlers-Danlos syndrome, forming a “stop” codon and resulting in shortened procollagen. Consult the genetic code and suggest one way that this can happen.
Choose a pentapeptied composed of five different amino acids. List the five amino acids.
Present the messenger RNA codons for the amino acids and the sequence of the nucleotids on the DNA that was originally coded for the pentapeptide.
The sequence of a polypeptide is determined by the order of codons that specify
the amino acids in the polypeptide. How many different sequences of codons can
specify the polypeptide sequence methionine-histidine-lysine? (Use the table to
find the number of possibilities.)
SECOND BASE
UAU
UACFTyrosine (Tyr)
UAA -Stop codon
UAG -Stop codon
UUUL
UGU
Cysteine (Cys)
UCU
uc
UCA FSerine (Ser)
uca
Uuc
Phenylalanine (Phe)
UUAL Leucine (Leu)
CAU
CAC
CAA Glutamine (Gin)
CAGF
UGA -Stop codon
uaa -Tryptophan (Trp)
CGU
сос
CGA FArginine (Arg)
CU
CU
Histidine (His)
CuA FLeucine (Leu)
Cua)
Proline (Pro)
CCA
cca
AAU Asparagine (Asn)
AGU Serine (Ser)
AGC
AUU
ACU
ACC
Threonine (Thr)
AACF
AAA
AAGLysine (Lys)
AUC Fisoleucine (lle)
AUA
Methionine (Met)
AUG -
Start codon
ACA
ACG
AGA
AGGFArginine (Arg)
GU
GACAspartic acid (Asp)
GGA
GAA Glutamic acid (Glu) Gaa)
GcU
-Valine (Val)
G GUA
GCA FAlanine (Ala)
Glycine (Gly)
8.
1
4
THIRD BASE
2.
FIRST BASE
Chapter 15 Solutions
Biology: The Dynamic Science (MindTap Course List)
Ch. 15.1 - Prob. 1SBCh. 15.1 - If the codon were five bases long, how many...Ch. 15.2 - For the DNA template below, what would be the...Ch. 15.2 - Prob. 2SBCh. 15.3 - Prob. 1SBCh. 15.3 - Prob. 2SBCh. 15.4 - Prob. 1SBCh. 15.4 - Distinguish between the P, A, and E sites of the...Ch. 15.4 - Prob. 3SBCh. 15.5 - How does a missense mutation differ from a silent...
Ch. 15.5 - Prob. 2SBCh. 15.5 - Prob. 3SBCh. 15.5 - Prob. 4SBCh. 15 - Eukaryotic mRNA: usessnRNPs to cut out introns and...Ch. 15 - A segment of a strand of DNA has a base sequence...Ch. 15 - Prob. 3TYKCh. 15 - Prob. 4TYKCh. 15 - Which of the following statements is false? a. GTP...Ch. 15 - Prob. 6TYKCh. 15 - Prob. 7TYKCh. 15 - Prob. 8TYKCh. 15 - Prob. 9TYKCh. 15 - A part of an mRNA molecule with the sequence 5-UGC...Ch. 15 - Discuss Concepts A mutation occurs that alters an...Ch. 15 - Discuss Concepts The normal form of a gene...Ch. 15 - Prob. 13TYKCh. 15 - Prob. 14TYKCh. 15 - Prob. 15TYKCh. 15 - Prob. 16TYKCh. 15 - Prob. 17TYKCh. 15 - Prob. 1ITD
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A group of 3 nucleotides codes for one amino acid. How many codons are needed to make the polypeptide that results?arrow_forwardThe amino acid glycine is encoded by four codons: GGA, GGC, GGG, and GGU. Which of the following statements correctly explains this fact? The glycine anticodon contains the sequence CC, but the 5' base of the anticodon can pair nonspecifically with the 3' base of the codon. The glycine anticodon contains the sequence CC, but the 3' base of the anticodon can pair nonspecifically with the 5' base of the codon. Glycine tRNA has four anticodons, and the appropriate anticodon specifically pairs with the correct codon. There are four tRNAs for glycine, each of which has an anticodon that specifically pairs with the correct codon. all of the abovearrow_forwardThe genetic code is thought to have evolved to maximize genetic stability by minimizing the effect on protein function of most substitution mutations (single-base changes). We will use the six arginine codons to test this idea. Consider all of the substitutions that could affect all of the six arginine codons.(a) How many total mutations are possible?(b) How many of these mutations are “silent,” in the sense that the mutantcodon is changed to another Arg codon?(c) How many of these mutations are conservative, in the sense that an Argcodon is changed to a functionally similar Lys codon?arrow_forward
- Refer to the genetic code in Figure 15.10 to answer the following question Q. If a single transition occurs in a codon that specifies Leu, what amino acids can be specified by the mutated sequence?arrow_forwardRefer to the genetic code in Figure 15.10 to answer the following question Q. If a single transition occurs in a codon that specifies Phe, what amino acids can be specified by the mutated sequence?arrow_forwardTranslate the following RNA sequence by using the genetic below. Start at the beginning of the sequence and don't worry about start and stop codons. Write out the sequence using the single letter code. (This table displays the amino acids in a single-letter code instead of a three-letter code. Each codon is found by matching the first position on the left of the chart, second position at the top, and last position at the right. For example, the codon CAG gives the amino acid "Q") 5' UCAACUGCGAAUCUGGAAUAU 3'arrow_forward
- Translate the following RNA sequence by using the genetic below. Start at the beginning of the sequence and don't worry about start and stop codons. Write out the sequence using the single letter code. (This table displays the amino acids in a single-letter code instead of a three-letter code. Each codon is found by matching the first position on the left of the chart, second position at the top, and last position at the right. For example, the codon CAG gives the amino acid "Q") 5' UCAACUGCGAAUCUGGAAUAU 3'arrow_forwardConsider this nucleotide sequence of DNA strand in the image provided. If this strand is the sense strand, Give the correct nucleotide sequence of the RNA produced after transcription. If the RNA formed in #1 is already a functional mRNA and will be used to synthesize proteins, how many codons are present here that will actually code for amino acids? What is the sequence of the stop codon in this mRNA? What is the sequence of the 3rd codon in this mRNA? What is the sequence of the last codon in this mRNA that actually code for an amino acid?arrow_forwardUse the genetic code table to determine the amino acid sequence of the given message strand of DNA below, from N to C terminal. All introns were removed in this sequence for simplicity. Write the amino acids in their 3-letter abbreviation and separate with a dash.arrow_forward
- Codons in the set CUU, CUC, CUA, and CUG all code for the amino acid leucine. In this set, the first and second bases are identical; the identity of the third base is irrelevant. For what other sets of codons is the third base also irrelevant? For what amino acid(s) does each set code?arrow_forwardDecode the unknown word using the genetic code and fill out the missing nucleotides. Translate the generated mRNA sequence using the universal genetic code table and the information derived from the previous steps. Determine the unknown word by arranging the single letter amino acid code of the hypothetical protein produced bound by the start and stop codon.arrow_forwardDescribe the process where a peptide chain is formen from a code embedded in a nucleic acid molecule. Name the process, which mavromolecule plays a central role and which nucleic acid molecule is involved? What is the codon and how is the codon involved? How is it ensured that correct amino acid and in the correct order are bonded together?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY