The sequence of a segment of mRNA, beginning withthe initiation codon, is given here, along with the corresponding sequences from several mutant strains.Normal AUGACACAUCGAGGGGUGGUAAACCCUAAG...Mutant 1 AUGACACAUCCAGGGGUGGUAAACCCUAAG...Mutant 2 AUGACACAUCGAGGGUGGUAAACCCUAAG...Mutant 3 AUGACGCAUCGAGGGGUGGUAAACCCUAAG...Mutant 4 AUGACACAUCGAGGGGUUGGUAAACCCUAAG...Mutant 5 AUGACACAUUGAGGGGUGGUAAACCCUAAG...Mutant 6 AUGACAUUUACCACCCCUCGAUGCCCUAAG...a. Indicate the type of mutation present in each, andtranslate the mutated portion of the sequence intoan amino acid sequence in each case

Q: al mRNA: 5’- AUG GGC UCG ACC UUG -3’ Mutant mRNA 1: 5’- AUG GGC UAG ACC UUG -3’ Mutant mRNA 2: 5’-…

A: The physical and functional unit of heredity is the gene. They pass on knowledge from one generation…

Q: Is the RNA-coding sequence likely to be from a bacterial cell or from a eukaryotic cell? How can you…

A: The mRNA coding sequence doesn't contain non coding part (intron). Introns are transcribed to…

Q: The following segment of DNA is part of the RNA-coding sequence of a transcription unit. If the…

A: Introduction  Deoxyribonucleic acid is a polymer made of two polynucleotide chains that coil around…

Q: Assume the following portion of an mRNA. Find a start signal, and write the amino acid sequence that…

A: The sequence of protein is usually notated as a string of letters, according to the order of the…

Q: Below is a DNA sequence of the coding strand for a small gene. This gene has no introns.

A: 1. This is a prokaryotic gene because of the absence of introns. In eukarytoes, both introns and…

Q: CGA CUA CCA UCA ACA GUA GGA GGC CCGC AUA CUC CCC UCC ACC GUC 3 CGG GAC AAC UGC GAA CAA GGG CAC AUC…

A: The process of synthesis of proteins with the help of messenger RNA is called translation. Proteins…

Q: (iii) Based on the double-stranded DNA sequence of terminator, draw the structure of hairpin loop…

A: Hairpin loop structure It is the secondary structure of mRNA where the complementary base pairing…

Q: Find 5’ UTR and 3’UTR of Mrna 5’  AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA…

A: All the living cells are made up of protein, which acts as building blocks for every organism. These…

Q: Assume a bacterial gene underwent a mutation, where a thymine base from an early portion of the…

A: Protein consists of amino acids.

Q: A molecular geneticist hopes to find a gene in human liver cells that codes for an important…

A: With the help of the Human Genome Project, it has now become possible to sequence all of the genes…

Q: Based on the sequence data in the figure above, would you consider the patient to be not affected,…

A: Based on the information provided in the figure above, it can be concluded that the patient is…

Q: You may wish to consult the genetic code above to answer the following question. A mutation has…

A: Mutation is the sudden change in the base pair of sequence resulting in altered phenotype. The…

Q: What is the consensus sequence of the following six DNA…

A: DNA or the Deoxyribonucleic acid present in both eukaryotes and prokaryotes are made up of millions…

Q: The most common MCAD mutation is shown below. The coding strand is shown for both the WT and mutant.…

A: 5’ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGCATAGCATACTGAGGGTAGTAG-3’…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: Please write the sequence of the mRNA transcript transcribed from the given DNA double helix by…

A: Transcription is the process by which the information contained in DNA  is converted into a…

Q: Be sure to answer all parts. Consider the following mRNA sequence: 5'-GCU AGG CGA-3'. a. What amino…

A: Translation is the process in which the m rna is converted into a polypeptide chain of amino acids…

Q: ) The deacetylation of histones generally causes gene inactivation. True or false?

A: Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: b) Shown below is a very short gene of an unknown bacteria genome (Figure 2). Transcription starts…

A: The mRNA is produced from the templates stand of DNA by the transcription process and polypeptide…

Q: The following eukaryotic DNA sequence is a made up gene. It is a mutated variant from the one that…

A: The genetic framework is a collection of instructions used by living cells to decipher data encoded…

Q: What potential polypeptides can be produced from the following mRNA sequence? There are more than…

A: In our body genetic information is stored in form of DNA. DNA multiples itself by replication. DNA…

Q: For this double stranded DNA: 3’-AGGTCCAGTCTTCGGCGGATGATCGGGCCAACCCCCGTAACTGGTCACCGGAATGCC-5’…

A: 4 codes are used by the DNA that areAdenine (A), Thymine (T),  Guanine (G), Cytosine (C)RNA also…

Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…

A: A DNA molecule is a double-helical structure.

Q: If the mRNA transcribed for this gene will be translated into a functional protein, how many amino…

A: Introduction  Gene expression is the process through which a gene's information is used to create a…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: A molecular geneticist hopes to find a gene in human liver cells that codes for an important…

A: The nucleotides sequence of the small part of the gene of interest is GTGGACTGACA as given in the…

Q: ii) If the nucleotide indicated by the highlighted bold letter undergoes a mutation that resulted in…

A: A gene is a functioning heredity unit made up of DNA that provides instructions for the creation of…

Q: You are studying a eukaryotic gene in which translation normally begins at the second AUG in the…

A: Self-explanatoryPlease give me a helpful rating if you are satisfied with my answer

Q: The code for a fully functional protein is actually coming from an mRNA transcript that has…

A: As per the central dogma of molecular biology information stored within the DNA is transcribed onto…

Q: The DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are…

A: A genetic code is a table consisting of 64 codons each of which code for specific amino acids. These…

Q: transcription initiation site GCAGTGACCGGATATAACGAAGAGGAATGCCGTACAAA 5' UCCUUAC 3' Which of the…

A: Coding strand is the that strand of DNA whose sequence is identical to the mRNA sequence while…

Q: The following is a DNA sequence of gene Z. The underlined sequence represents the promoter for gene…

A: In molecular biology, mRNA is a single-stranded molecule of RNA that corresponds to the genetic…

Q: b) Shown below is a short gene of an unknown bacteria genome (Figure 2). (Note: Transcription starts…

A: Hair pin loop is a self complementary Terminator sequence which is formed when the RNA transcription…

Q: The mRNA sequence 5' AUG AAA CAG GGA UAA 3' encodes a particular peptide of interest to your…

A: Gene is the segment of DNA (deoxyribonucleic acid) that is responsible for heredity and inheritance…

Q: Below is the CODING sequence of a gene. An A is inserted at position 131. Insert the variant and…

A: Introduction  Central Dogma: it is the key mechanism by which DNA can be transcribed into mRNA by…

Q: The template strand of a gene has the sequence 5'-ATGCCTAGCCTAGGACT-3', What will the sequence of…

A: Here, the question is asking about mRNA transcript whose synthesis takes place in 5'-3' direction…

Q: Hemophilia in the Russian royal family was caused by defective protein involved in blood clotting…

A: Answer- Hemophilia is the X-linked recessive disease in which a patient looses the ability to clot…

Q: The following DNA sequence has been determined from DNA isolated from a bit of prehistoric amber…

A: In order that a polypeptide is formed from a DNA sequence, two processes are required to take place.…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.