The sequence of a segment of mRNA, beginning withthe initiation codon, is given here, along with the corresponding sequences from several mutant strains.Normal AUGACACAUCGAGGGGUGGUAAACCCUAAG...Mutant 1 AUGACACAUCCAGGGGUGGUAAACCCUAAG...Mutant 2 AUGACACAUCGAGGGUGGUAAACCCUAAG...Mutant 3 AUGACGCAUCGAGGGGUGGUAAACCCUAAG...Mutant 4 AUGACACAUCGAGGGGUUGGUAAACCCUAAG...Mutant 5 AUGACACAUUGAGGGGUGGUAAACCCUAAG...Mutant 6 AUGACAUUUACCACCCCUCGAUGCCCUAAG...a. Indicate the type of mutation present in each, andtranslate the mutated portion of the sequence intoan amino acid sequence in each case

Q: al mRNA: 5’- AUG GGC UCG ACC UUG -3’ Mutant mRNA 1: 5’- AUG GGC UAG ACC UUG -3’ Mutant mRNA 2: 5’-…

A: The physical and functional unit of heredity is the gene. They pass on knowledge from one generation…

Q: CGA CUA CCA UCA ACA GUA GGA GGC CCGC AUA CUC CCC UCC ACC GUC 3 CGG GAC AAC UGC GAA CAA GGG CAC AUC…

A: The process of synthesis of proteins with the help of messenger RNA is called translation. Proteins…

Q: (iii) Based on the double-stranded DNA sequence of terminator, draw the structure of hairpin loop…

A: Hairpin loop structure It is the secondary structure of mRNA where the complementary base pairing…

Q: 2. Complete the leading strand and the complementary strand with the 5'and 3' ends and identify the…

A: DNA acts as the genetic material in most of the organisms present on earth. DNA is first transcribed…

Q: Find 5’ UTR and 3’UTR of Mrna 5’  AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA…

A: All the living cells are made up of protein, which acts as building blocks for every organism. These…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: A mutation is found in a tRNA-encoding gene. The wild type (non-mutant) allele (version) produces a…

A: tRNA (transfer RNA) is a type of RNA that helps decode the genetic information in mRNA to build…

Q: What are the current clinical trials for treating malaria disease?

A: Malaria infection is associated with fever with chills. It is caused by a protozoan called…

Q: Given the DNA sequence TATAGCACTGAT, which of the following is the correct complementary mRNA…

A: In the process of protein synthesis, DNA is transcribed into mRNA. Complementary base pairing rules…

Q: Which is the coding strand? Which is the template strand? What is the direction of mRNA…

A: The process of synthesizing a messenger RNA (mRNA) molecule from a DNA template is known as mRNA…

Q: Be sure to answer all parts. Consider the following mRNA sequence: 5'-GCU AGG CGA-3'. a. What amino…

A: Translation is the process in which the m rna is converted into a polypeptide chain of amino acids…

Q: ) The deacetylation of histones generally causes gene inactivation. True or false?

A: Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: Hemophilia in the Russian royal family was caused by defective protein involved in blood clotting…

A: Hemophilia -- It occurs in about 1 of every 5000 males .     Usually a inherited disorder in which…

Q: b) Shown below is a very short gene of an unknown bacteria genome (Figure 2). Transcription starts…

A: The mRNA is produced from the templates stand of DNA by the transcription process and polypeptide…

Q: b) Shown below is a short gene of an unknown bacteria genome (Figure 2). (Note: Transcription starts…

A: The process of prokaryotic transcription results in messenger RNA transcripts. Translation and…

Q: What potential polypeptides can be produced from the following mRNA sequence? There are more than…

A: In our body genetic information is stored in form of DNA. DNA multiples itself by replication. DNA…

Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…

A: A DNA molecule is a double-helical structure.

Q: The following sequence is from a region of the M13 bacteriophage genome. Identify and label the…

A: Viruses do not have a living cell like other organisms. They have genetic material encapsulated…

Q: Refer to the genetic code in Figure 15.10 to answer the following question Q. If a single…

A: Proteins are the translational products of the genetic information encoded in the nucleotide series…

Q: Consider the following gene with their respective introns and exons   5’ –…

A: Since you have asked multiple questions, we will solve the first three question for you. If you want…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: Write down the complementary mRNA sequence for each of the following DNA sequence. A:…

A: If template sequence of the DNA is A..   mRNA is .. AUGGAUCGCGUGUACAUCCACCCGUUUCAA

Q: Dystrophin is mutated in the disease, causing a codon to change from GGA to UGA. What is the…

A: Dystrophin is a protein that helps keep muscle cells intact.

Q: ii) If the nucleotide indicated by the highlighted bold letter undergoes a mutation that resulted in…

A: A gene is a functioning heredity unit made up of DNA that provides instructions for the creation of…

Q: The tollowing mRNA transcript would result in which polypeptide sequence? 5'-ACU UUC ACU AUG UUU UUA…

A: Protein consists of amino acids linked by amide bonds or peptide bonds.

Q: You are studying a eukaryotic gene in which translation normally begins at the second AUG in the…

A: Self-explanatoryPlease give me a helpful rating if you are satisfied with my answer

Q: An anticodon of tRNA has the sequence GCA. What amino acid does this tRNA carry? HINT: you use mRNA…

A: Codons are in the form of triplets , for example AUG that codes for methionine ( amino acid). Codons…

Q: The code for a fully functional protein is actually coming from an mRNA transcript that has…

A: As per the central dogma of molecular biology information stored within the DNA is transcribed onto…

Q: Based on sequences A,B,C. Provide an anticodon sequence that would build this protein.

A: Codons are the sequences of nucleotides present on the mRNA strand, the tRNA (transfer RNA) brings…

Q: Choose one of the strands and transcribe the strand. Show the steps (with proper label) and do a…

A: DNA is the store house of genetic information. This information is transferred to mRNA through the…

Q: Hemophilia in the Russian royal family was caused by defective protein involved in blood clotting…

A: Nonsense mutations occur when a premature nonsense or stop codon is introduced in the DNA sequence.…

Q: Shown below is a very short gene of an unknown bacteria genome (Figure 2). Transcription starts at…

A: Transcription proceeds until the main enzyme RNA polymerase encounters a termination sequence that…

Q: What type of RNA is involved in the post-transcriptional modification illustrated below? 5' 5' 3' 5'…

A: Post transcriptional modification is a very important step in an eukaryotic cell, where the primary…

Q: transcription initiation site GCAGTGACCGGATATAACGAAGAGGAATGCCGTACAAA 5' UCCUUAC 3' Which of the…

A: Coding strand is the that strand of DNA whose sequence is identical to the mRNA sequence while…

Q: The following is a DNA sequence of gene Z. The underlined sequence represents the promoter for gene…

A: In molecular biology, mRNA is a single-stranded molecule of RNA that corresponds to the genetic…

Q: b) Shown below is a short gene of an unknown bacteria genome (Figure 2). (Note: Transcription starts…

A: Hair pin loop is a self complementary Terminator sequence which is formed when the RNA transcription…

Q: b) In eukaryotes, the newly synthesized mRNA undergoes modifications before it is transported across…

A: In eukaryotic cells, transcription is a process in which genetic information in the DNA is converted…

Q: Refer to the genetic code in Figure 15.10 to answer the following question Q. If a single…

A: A codon refers to a specific sequence of deoxy ribonucleotide (DNA) or ribonucleic acid (RNA), which…

Q: A given coding strand sequence in a Eukaryote is as follows 5'GGGAATATAA GACCGATGGA GGGTACAG…

A: Central Dogma is a flow of information that is present in the form of nucleotide sequence on the DNA…

Q: Below is the CODING sequence of a gene. An A is inserted at position 131. Insert the variant and…

A: Introduction  Central Dogma: it is the key mechanism by which DNA can be transcribed into mRNA by…

Q: The template strand of a gene has the sequence 5'-ATGCCTAGCCTAGGACT-3', What will the sequence of…

A: Here, the question is asking about mRNA transcript whose synthesis takes place in 5'-3' direction…

Q: Consider the following mature mRNA from a human cell: 5' UAAUGUCGCAAUAACC 3¹ What is the sequence of…

A: Gene is a hereditary unit which helps in transfer of genetic information. Genetic information is…

Q: Using the genetic code below, decipher the following mRNA sequence.…

A:

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.