a. Below is a portion of a bacterial chromosome that contains a gene. The promoter region and the +1 base pair are indicated, as well as the direction (5' and 3') of the two DNA strands. +1 -10 -35 .3'тTGCATCСGAAАCGTACGATCGATCEGCCGACTТАТТАСGATCGGACTAФTGCGTCсТAGC5'... ...5'AACGTAGGCTTTGCATGCTAGCTAGCCGGCTGAATAATGCTAGCCTGATGACGCAGCATCG3'.. (i) Write the first 12 nucleotides of the RNA molecule transcribed from this gene. Be sure to indicate the 5' and 3' ends from left to right of the RNA strand. (ii) Explain why the Start codon does not appear in the first three nucleotides of the sequence transcribed in (i). 2.

Q: The following is the base sequence of DNA that codes for first eight amino acids of the β chain of…

A: As per the bartleby guidelines experts are allowed to answer only 3 sub-parts for a question. The…

Q: DNA sense or template DNA sense or template mRNA tRNA protein 5', 3' amino or carboxyl 5' T A U A R…

A: DNA -> Transcription -> mRNA -> Translation -> ProteinTranscription is the synthesis of…

Q: What are the functional consequences of this deletion for lilP mRNA transcription and translation?…

A: Introduction :- A deletion mutation is a type of genetic mutation that involves the loss of one or…

Q: 7a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of…

A: DNA is the genetic material present in most of the living organisms. The DNA is made up of 4…

Q: 4. The template strand from the previous question is mutated to the DNA sequence shown below: 3' GTC…

A: transcription is the process by which messenger rna is made from dna .

Q: Which of the following represents the sequence of an RNA transcript for which the template strand of…

A: The deoxyribonucleic acid (DNA) is the nucleotide sequence that stores the genetic information of an…

Q: 1. Write the complementary coding strand sequence 5' GGG ATG TCA CAC ATA TTT 2. Write the mRNA…

A: The coding strand of DNA is the one that contains the instructions for the gene in concern. The…

Q: The most common MCAD mutation is shown below. The coding strand is shown for both the WT and mutant.…

A: 5’ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGCATAGCATACTGAGGGTAGTAG-3’…

Q: "The design of trans-Tango is modular, so it is not limited to tracing experiments. Since the…

A: It is certainly possible to further advance the trans-Tango system to label third-order neurons,…

Q: Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA…

A: The core dogma notes that the sequence of learning most commonly found in our cells is: From…

Q: Below is a portion of an exon from a gene that encodes protein Y in the genome of the plant…

A: Ans 1 :  Yes, there is a mutation in third codon when counting from 5/ to 3/ on template strand in…

Q: 8a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of…

A: Mutation can be defined as change in nucleotide sequence of a gene. Based on the type of change,…

Q: What restriction enzyme (or enzymes) would you use to cut the following...   (Gene of Interest is…

A: Forward Primer:5'-TCTAGAGTCAATGAAACAACA-3'Explanation:This sequence starts with the same…

Q: Based on the following wild type DNA sequence, indicate if each of the mutations should be…

A: A mutation is a change in a DNA sequence. Mutations can result from DNA copying mistakes made during…

Q: Decide on two restriction sites that you can use to clone this into pL4440’s MCS. Identify their…

A: DNA cloning restriction sites are specific DNA sequences recognized and cleaved by restriction…

Q: The following sequence is from a region of the M13 bacteriophage genome. Identify and label the…

A: Viruses do not have a living cell like other organisms. They have genetic material encapsulated…

Q: Decide on two restriction sites that you can use to clone this into pL4440’s MCS. Identify their…

A: The recombinant DNA technology use plasmid to transfer foreign DNA into the host organism in which…

Q: You want to examine genetic variation in your gene promoter. You sequence DNA from several…

A: Single nucleotide polymorphism; it is a type of genetic variation which can occur throughout a…

Q: If the promoter is here and transcription starts here…

A: Transcription is the process of formation of RNA using DNA as a template.

Q: The arrow in the diagram below indicates the direction of transcription. A BTTT…

A: Q. Ans:- The given image shows the process of transcription. Transcription:- Transcription is a…

Q: 2ith the diagram provided please write the polypeptide. sequence obtained from the translation of…

A: INTRODUCTION Translation is the process of translating the sequence of a messenger RNA (mRNA)…

Q: In which strand is the promoter? 5' TCATGAGATA GCCATGCATA TCTAGTATGT AGGCATCTGA GTTTATATCT CA 3' 3'…

A: Phosphodiester linkages connect DNA strands, which are polymers or chains of deoxynucleoside…

Q: pc*00ATAAADDATATAJOTTAA 1. Use the genetic code table and the information in the diagram below to…

A: Gene is a part of the DNA, located on a specific site on the chromosome and has a specific sequence…

Q: Identify the type of point mutation on the following strands (transition or transversion):  a. 5’…

A: The mutation is the sudden deleterious effects in the DNA sequences, they can arise when the DNA is…

Q: he Sequence below comes from the alpha-2 globin of the human hemoglobin gene cluster found in…

A: Given: The sequence of the alpha-2 globin of the human hemoglobin gene cluster found in chromosome…

Q: (11) If you design a gRNA with the sequence, GGU AUC AUU GCA CUG ACC AG, in theory which position of…

A:

Q: G-LO37 Identify the consequences of mutations in different regions of a gene. The image below…

A: A mutation is a change to an organism's DNA sequence. Errors in DNA replication during cell…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.