The arrow in the diagram below indicates the direction of transcription. A BTTT AUGCCGCAAUCUGUUCACGCACUCAUG Direction of synthesis- ATGCCG CA TACGGCGTTAGAC CL OA B TTCACGCACTCATGTGT AAAGTGCGTGAGTACA Which letter indicates an RNA strand? TTTTE TACCACGTA D ATGGTGCAT F

Q: DNAT  A  C        C  G  C     T  C  C       G  C  C       G  T  C       G  A  C      A  A  T…

A: The self-replicating biomolecules that are present in the chromosomes and carry genetic information…

Q: DNAT  A  C       C  A  C        C  C  C       C  G  T         A  T  G        G  C  T      G  G  G…

A: DNA and RNA acts as a genetic matter that carry the genetic information from one generation to…

Q: The DNA sequence contains the complete sequence for a small gene. What amino acid sequence does this…

A: DNA sequence of genes code for the sequence of amino acids in proteins. There are two strands in…

Q: DNA G C A strand DNA TA C TA C strand MRNA A U G U G codon TRNA anticod G on Amino Tryptoph Stop…

A: DNA is deoxyribonucleic acid which acts as a source of genetic material inside living organisms. DNA…

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: DNA TAC-TAA-AGG-GAA-GAC-GAG-ATC mRNA AA

A: DNA synthesis or DNA Replication-It is the process by which a cell duplicates its genome(DNA)…

Q: Shown below is the " sense" strand of DNA. Second letter U What is the amino acid sequence that…

A: Introduction :- Deoxyribonucleic acid (DNA) is a molecule made up of two polynucleotide chains that…

Q: Use the table of the codons to answer the following question. Starting with the start codon, what is…

A: A codon is a sequence of three consecutive nucleotides in a DNA or RNA molecule that codes for a…

Q: The process of transcription is represented by letter

A: DNA is transcribed into mRNA and mRNA is translated into protein.

Q: Using the table above and the mRNA transcript AUG-CUC-UAC-AAG-UAG, choose the false statement: XXX…

A: Nucleic acids are involved in various processes in the cell, their main role is the expression of…

Q: sing the genetic code provided what would be the corresponding polypeptide sequence for the DNA…

A: The DNA is transcribed into the RNA by the process of transcription and the RNA is translated into…

Q: Transcription and Translation Practice Directions: Read each sequence of DNA and transcribe it to…

A:

Q: Which arrow in the diagram of transcription below is labeling the 'SENSE DNA strand? Note that the…

A: A DNA sequence is transcribed into an RNA molecule with the help of the enzyme RNA polymerase is…

Q: GGCACCTGCGATGCATGAATATATCGATCGGGAATCGCTATGTCAAGCCATGGCTAGATTA…

A: m RNA sequence is created by the enzyme called RNA polymerase that copies the nucleotides according…

Q: Attached is a region of DNA containing a transcription unit. Match the boxes with the terms…

A: The DNA contained the genetic information that is transcribed into mRNA by the process of…

Q: Give the mRNA and amino acid sequence from this DNA strand: TACATACCTCGGCTTTGGCTGAAAGGTACTTATAATGCT

A: By the process of transcription the DNA strand is transcribed into mRNA within the nucleus of the…

Q: Second base of codon U A G UCU Phenylalanine UAU UUU UGU Cysteine U Tyrosine tyr y UUC phe F UCC UAC…

A: A) The Adenine (A) is present in the intron or non-coding part of the gene, transcription results in…

Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…

A: A DNA molecule is a double-helical structure.

Q: Coding strand: Template strand: 5' AAGACCTATATAATGACGAACGATATT 3 3 TTCTGGATATATTACTGCTTGCTATAA 5

A: Transcription is the process that synthesis the mRNA transcript from the double-stranded DNA by the…

Q: quizzes/85114/take WebSTAC Dashboard Workday Help | Wa... Home - Workday b Identify the W Second…

A: DNA complementary-CCG ATC TGA GTA TAG CCC  mRNA- GGC UAG ACU CAU AUC GGG

Q: 7 Which of the following is the correct polypeptide chain for the mRNA strand shown below?…

A: The polypeptide is formed by the process of the translation process, where mRNA carries codons…

Q: Match a descriptor to each region of the diagram for transcription and translation. case 00 ACCOCO…

A: The copying of a DNA segment into RNA is known as transcription.In this process the DNA segment is…

Q: Write down the complementary mRNA sequence for each of the following DNA sequence. A:…

A: If template sequence of the DNA is A..   mRNA is .. AUGGAUCGCGUGUACAUCCACCCGUUUCAA

Q: Below is a DNA template strand for RNA transcription where the * and “ mark the beginning and end of…

A: Transcription is the process by which the information in a DNA strand (template) is copied into a…

Q: 5. Below is a segment of RNA, transcribed from a DNA sequence. Use the following codon chart to help…

A: A. The polypeptide generated by the given RNA sequence is "Met-Pro-Thr-Asp-Trp-Pro."b. The mutation…

Q: Consider an image of an mRNA being translated. fMet Pro HAUG COCACG

A: In biology, "translation" refers to the second stage of protein synthesis, which is the process by…

Q: Directions: Transcribe the following strand into mRNA, then translate it into amino acids. Use…

A: We'll see into one particular occurrence of this procedure here. A DNA sequence will be the…

Q: Now imagine that a mutation occurred in the g of the codon below and the G became a C. How would…

A: a mutation occurred in the g of the codon below and the G became a C   A  T  G Changes to A  T  C…