quizzes/85114/take WebSTAC Dashboard Workday Help | Wa... Home - Workday b Identify the W Second letter U A UUU1 UCU UCC Phe UAU] UGU UUCJ UAC Tyr UGC Cys U UUA Leu UUG Ser UAA Stop UGA Stop A UAG Stop UGG Trp UCA UCG CUU CAU His CCU CGU CUC CCC CAC CCC UCAGU

Q: The following sequence represents the dsDNA code for a short peptide 5' -CTT TCC CAT CAC CGC ATG…

A: 3= No , it is not possible for codon to code for another amino acid . 4= UAA is a stop codon , if…

Q: DNA sequence

A: This is defined as the process in which cells make proteins. This occurs in 2 stages which include…

Q: The following segment of DNA is part of the RNA-coding sequence of a transcription unit. If the…

A: Introduction  Deoxyribonucleic acid is a polymer made of two polynucleotide chains that coil around…

Q: Given the following stretch of mRNA, what would be the sequence of the corresponding non-template…

A: DNA stands for deoxyribonucleic acid. It is the genetic material of cell.

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: The DNA in the coding strand below contains a short imaginary sequence for a short protein in…

A: DNA sequence: 5'-ATGTACCTCGACGATCAAGGCAA-3'1. m RNA sequence:Due to complementary base pairing rules…

Q: List the 4 types of RNA degradation and describe each in 1 sentence

A: RNA degradation is the process by which ribonucleic acid molecules are enzymatically degraded. It is…

Q: A single nucleotide addition and a single nucleotide deletion approximately 15 bases apart in the…

A: Gene is the structural and functional unit in the DNA. Genes are composed of nucleotide nitrogenous…

Q: The following sequence represents a few codons present in one strand of DNA.Using this strand of DNA…

A: DNA replication is the process of formation of copies of DNA. It takes place in nucleus of cell.…

Q: The following double stranded segment of DNA is part of a protein coding gene. The segments in…

A:

Q: DNA TAC-TAA-AGG-GAA-GAC-GAG-ATC mRNA AA

A: DNA synthesis or DNA Replication-It is the process by which a cell duplicates its genome(DNA)…

Q: Translate this DNA sequence using Genetic Code 5' - ATG GGG cCC GTC CAT CCG TAC GCC GGA ATT ATA - 3'…

A: DNA is transcribed into mRNA through the process of transcription. mRNA is then translated into…

Q: Given the DNA sequence TATAGCACTGAT, which of the following is the correct complementary mRNA…

A: In the process of protein synthesis, DNA is transcribed into mRNA. Complementary base pairing rules…

Q: The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1)…

A: At first you have to know about coding and non-coding strand. A coding atrand is a DNA strand that…

Q: Given the following DNA sequence of the template (i.e. noncoding) strand for a given gene:…

A: The double-stranded DNA molecule is made up of two DNA strands known as the template strand and the…

Q: Use the numbers below to indicate the correct order of events (from left to right) during the…

A: Hi, Thanks For Your Question.  Answer : Correct Sequence Is 3 4 2 1 5.

Q: For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: b) the sequence of the…

A: The given DNA sequence is as follows 3’–CGATACGGCTATGCCGGCATT–5' The above given strand is a…

Q: The following base sequence is a complete polynucleotide made in a bacterial cell. AUG, GCC, AUG,…

A: The process of transcription entails creating mRNA from a DNA template. A complementary mRNA strand…

Q: Consider the following DNA sequence, which codes for a short polypeptide:…

A: A codon is a sequence of three nucleotides (in DNA or mRNA) that specifies a particular amino acid…

Q: Write the standard base sequence of the messenger RNA that would cause a ribosome to make the…

A: The amino acids in the protein are placed in the order from N-terminus to C- terminus. The mRNA are…

Q: The following sequence of DNA is part of the normal, wild-type gene.   5'TAC CGG GAC TTG AGC CGA…

A: A single nucleotide from the DNA is deleted in nucleotide deletion. Although the single nucleotide…

Q: If DNA segments changes from GCATAG to GCATGG, this is a: MRNA Codon/Amino Acid Chart First Base…

A: The DNA sequence GCATAG will have the mRNA code CGUAUC. When the sequence changed to GCATGG, then…

Q: Write corresponding mRNA code and the amino acid acid sequence for the DNA segment with the…

A: Transcription is a process of formation of transcript or RNA from DNA by the process of…

Q: Given the following coding strand of DNA: 3' – TACCGAGTACTGACT – 5', the mRNA that will transcribed…

A: The method of constructing an RNA copy of a genetic sequence is known as transcription. The copy,…

Q: Using the codon chart, if the DNA strand being described is AGG TCT GAT , the resulting amino acid…

A: The order in which amino acids are found in a protein. Proteins are made up of 20 different types of…

Q: A segment of template DNA is known to contain the following base sequence: 3'…

A: The DNA sequence given above is a template for transcription, which is the process by which mRNA…

Q: Construct a polypeptide chain by translating the given red strand of the mRNA segment.…

A: Translation It is defined as the process of protein synthesis in which the sequence of mRNA is…

Q: A section of an mRNA has the following nucleotide sequence: GCA GCU UGC CAG For the mRNA sequence…

A: In the question, we are given with mRNA sequence. mRNA is a sequence of ribonucleotides synthesized…

Q: Which of the following interactions in E. coli ensures that the start codon of an mRNA is accurately…

A: The translation is the process of producing protein mRNA as a template and peptidyl activity of the…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.