A section of an mRNA has the following nucleotide sequence: GCA GCU UGC CAG For the mRNA sequence shown above, identify the following: DNA sense strand codons DNA antisense strand codons tRNA anticodons amino acids DNA Sense   DNA Antisense   mRNA GCA GCU UGC CAG tRNA   Amino Acids

Q: A Section of a Gene CTA AAA TAG TCT For the DNA sequence shown above, identify the following: mRNA…

A: A biological process in which the information present in DNA is copied to RNA (mRNA) is known as…

Q: Which of the following is not a term used to describe an unspliced mRNA? intronic mRNA O primary…

A: In eukaryotic genes, non coding DNA is also present. In most of the eukaryotic genes, coding…

Q: In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Then,…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: TRACE THE CODE| Order of bases in MRNA (codon) AUC Order of bases in ERNA (anticodon) Order of bases…

A: Complete this table of codes.

Q: Directions: Transcribe the following strand into mRNA, then translate it into amino acids Example…

A: We'll see into one particular occurrence of this procedure here. A DNA sequence will be the…

Q: Using the genetic code, indicate which polypeptides would be synthesized if poly-UGG were used in a…

A: Polypeptides are the linera chain of Amino acids Synthesised according to the codons on mRNA.…

Q: The following is a strand of mRNA: CAA GUG AAA ACA How many amino acids does the mRNA strand above…

A: The protein synthesis process requires the genetic material in the form of DNA to be transcribed…

Q: 1) Complete the following tables by filling in the DNA sequence, MRNA codons, and the amino acids…

A: The genetic material DNA is converted into RNA and this mRNA codes for a specific protein which is…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: de, translate the mRNA into an amino acid sequence.

A: Translation: It is the process by which sequence mRNA get translated into the sequence of amino acid…

Q: A section of an mRNA has the following nucleotide sequence: ACU UGC AGU GGU GUA For the mRNA…

A:

Q: The set of mRNAs present within a cell changes over time.Explain.

A: The conversion of a liquid into a gas is known as boiling or vaporization. The temperature at which…

Q: The molecule(s) that actually recognize and translate the genetic code into polypeptide sequence are…

A: Translation of genetic code into polypeptide chain is called translation.

Q: An mRNA may contain the sequence ATTGACCCCGGTCAA True/False

A: RNA or ribonucleic acid is a polymeric molecule essential in various biological roles in coding,…

Q: An mRNA has the following sequence:5′–AUG UAC UAU GGG GCG UAA–3′.Describe the amino acid sequence of…

A: Transcription DNA is converted to mRNA. this process is called transcription.

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: Indicate which of the following items are associated with transcription or translation.  This could…

A:

Q: DNA TAC-TAA-AGG-GAA-GAC-GAG-ATC mRNA AA

A: DNA synthesis or DNA Replication-It is the process by which a cell duplicates its genome(DNA)…

Q: If the DNA sequence is 3’ ATCGACGTC 5’, what is the mRNA sequence

A: DNA is the double helix structure. Two complementary strands present in the DNA. The direction of…

Q: The following RNA sequence represents a small messenger which can be translated in a prokaryotic…

A: The first step in translating an RNA sequence into a protein is to divide the sequence into codons,…

Q: The following DNA fragment was isolated from the beginning of a gene. Determine which strand is…

A: DNA, or deoxyribonucleic acid, is a molecule that carries the genetic instructions necessary for the…

Q: For each of the following sequences, fill in either the DNA, the mRNA sequence, or the amino acid…

A: The given mRNA sequence: AUG ACU AGC UGG GGG UAU UAC UUU UAG  The corresponding DNA sequence will be…

Q: The anticodon loop of the first tRNA that will complement this MRNA is Select one: O a. 5'-ACG-3' O…

A: Messenger RNA (mRNA): mRNA is a single-stranded RNA molecule that is complementary to one of the DNA…

Q: At least three types of RNA are required for protein synthesis. Compare and contrast mRNA, rRNA, and…

A: RNA or ribonucleic acid is a molecule which play a significant role in expression of genes via…

Q: AKS 5c1: The model below represents the process of protein synthesis. What is the best description…

A: Central Dogma of Molecular Biology explains the flow of information from DNA to RNA and then to…

Q: Write a mRNA sequence for the below nucleotide sequences ATTACACACAGCGCGTATACGCGCGCGGGCTATA

A: The mRNA sequence is considered the template strand used to form the chain of amino acids. A codon…

Q: Protein synthesis is a complicated process involving DNA being transcribed to RNA, which is then…

A: Protein synthesis is a complicated process involving DNA being transcribed to RNA, which is then…

Q: Below is a diagram of charged tRNAs in the active site of the ribosome during translation of the…

A: Translation is the process of synthesis of protein. It takes place in the cytoplasm.

Q: Transcribe the following DNA molecule into mRNA.  Make sure to find the start codon to begin your…

A: A start codon initiates the transcription while stop codon terminates the transcription process.

Q: Complete the complementary strand: mRNA transcription ATTCGAGGCTAA

A: The ribonucleic acid (RNA) molecule involves the transfer of the genetic information from the…

Q: The following sequence is the coding strand of a piece of DNA. Type out the corresponding template…

A: The protein sequence can be decoded by a coding or template DNA given. The mRNA strand is the same…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: Polypeptides can be reversed back to RNA because of the enzyme transcriptase. The genetic material…

A: The expression of the genetic material occurs generally through the production of proteins. This…

Q: Complete the box below:     Convert the following template strand of DNA bases into its…

A: The production of RNA from the DNA is known as transcription. This process is also known as gene…

Q: The tollowing mRNA transcript would result in which polypeptide sequence? 5'-ACU UUC ACU AUG UUU UUA…

A: Protein consists of amino acids linked by amide bonds or peptide bonds.

Q: SPLIT DNA mRNA TRNA Codon Anticodon Amino Acid A T C G G C A T A G T A A

A: The DNA is the genetic material that is responsible for the production of RNA transcription process.…

Q: The presence of a polyA tail in eukaryotic mRNA helps protect the mRNA from degradation. true/false

A: The poly-A tail is long chain consisting of adenine nucleotides which is added to mRNA molecule…

Q: A segment of mRNA produced by the normal order of DNA nucleotides and the corresponding amino acid…

A: Introduction   Genetic code or codon is a three nucleotide sequence present on mRNA. It gives the…

Q: Refer to the genetic code in Figure 15.10 to answer the following question Q. If a single transition…

A: Mutations are the alterations or the changes that occur in the DNA. Mutations are variations in…

Q: Group I and II introns are present in the following classes of RNAS. MRNAS O miRNAS SİRNAS TRNAS

A: Mobile introns are defined as the intervening sequences. These sequences are the ones that are…

Q: Construct a polypeptide chain by translating the given red strand of the mRNA segment.…

A: Translation It is defined as the process of protein synthesis in which the sequence of mRNA is…

Q: A Section of a Gene TGC GTG TAC CTA CCA For the DNA sequence shown above, identify the following:…

A: The given DNA sequence is as follows,  TGC GTG TAC CTA CCA

Q: Draw a eukaryotic mRNA that has been fully processed. Label the key parts including the Kozak…

A: The eukaryotic RNA is formed from the eukaryotic DNA by the process of transcription.

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.