The following bacterial DNA sequence uses the top strand as the coding strand and the bottom strand as the template strand. Write what the messenger RNA sequence for this gene would be after transcription occurs. **DNA Sequence Pair**In the image, a DNA sequence consisting of two strands is presented, demonstrating the complementary base pairing characteristic of DNA molecules.**Strand 1:**5' - TGTCACTGCACTGCATGTGTATGGTTCATGTACATTACATTATATACGCATGCGTACGCACGCTGTCAAGTGCATCGCGTCGACAG - 3'**Strand 2:**3' - ACAGTGACGTGACGTACACATACCAGTACGTAATGTAATATATGCGTACGCATGCGTGACGACAGTTCAACGTAGCGCAGCTGTC - 5'**Strand Structure:**- The two strands run antiparallel to each other, with the 5' end of one strand aligned with the 3' end of the other.- The bases pair through hydrogen bonds: Adenine (A) pairs with Thymine (T), and Cytosine (C) pairs with Guanine (G).- Bolded section in Strand 1 indicates a specific sequence that could be significant for binding sites or genetic markers.

Answered: Image /qna-images/answer/eedc1c41-268d-402d-9743-a0e01a48da26.jpg

Answered: what | bartleby

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Related questions

Question

The following bacterial DNA sequence uses the top strand as the coding strand and the bottom strand as the template strand. Write what the messenger RNA sequence for this gene would be after transcription occurs.

**DNA Sequence Pair**

In the image, a DNA sequence consisting of two strands is presented, demonstrating the complementary base pairing characteristic of DNA molecules.

**Strand 1:**
5' - TGTCACTGCACTGCATGTGTATGGTTCATGTACATTACATTATATACGCATGCGTACGCACGCTGTCAAGTGCATCGCGTCGACAG - 3'

**Strand 2:**
3' - ACAGTGACGTGACGTACACATACCAGTACGTAATGTAATATATGCGTACGCATGCGTGACGACAGTTCAACGTAGCGCAGCTGTC - 5'

**Strand Structure:**
- The two strands run antiparallel to each other, with the 5' end of one strand aligned with the 3' end of the other.
- The bases pair through hydrogen bonds: Adenine (A) pairs with Thymine (T), and Cytosine (C) pairs with Guanine (G).
- Bolded section in Strand 1 indicates a specific sequence that could be significant for binding sites or genetic markers.

Expert Solution

Step by step

Solved in 2 steps with 2 images

SEE SOLUTION Check out a sample Q&A here

Follow-up Questions

Read through expert solutions to related follow-up questions below.

Follow-up Question

Using the mRNA sequence you made, translate this into a protein sequence. Begin translation at the first AUG (start codon) in the sequence, starting from the mRNA 5’ end. When writing the amino acids that are found in the protein, you may use the single-letter code, three-letter code, or full amino acid names.

Solution

by Bartleby Expert

SEE SOLUTION

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions