3. Shown below is a double-stranded bacterial (E. coli) DNA sequence coding for a hypothetical protein.Both strands are shown; the top strand reads 5' to 3' left to right, while the bottom strand reads 5' to 3'right to left. The nucleotides are numbered 1 to 100. NOTE: For this problem, transcription begins withand includes the red and underlined C/G (top strand/bottom strand) base pair and RNA polymeraseproceeds from left to right along the DNA.120405'-GTGTCCGTСТААТАТТGTGAGATGTТАТАТСССGCСGTCAАСАССАТСАА-3'+-------+----------------+3'-САСAGGCAGATTATAACAСТСТАСААТАTAGGGCGGCAGTTCTGGTAGTТ-5'60801005'-ACAGGATAATCGCCTGCTGGGGCAAAGGCGGTGAAGGTAAAGGTGTTGCC-3'------+3'-TGTCCTATTAGCGGACGACCCCGTTTCCGCCACTTCCATTTCCACAACGG-5'a) Which strand is used as a template for transcription, the top or the bottom?b) Where would the promoter be relative to the start of transcription?c) What are the first 15 nucleotides of the resulting mRNA? Indicate the 5' and 3'ends of the mRNA.d) What are the first 5 amino acids translated from the resulting mRNA? Indicate theamino acids translated from the resulting mRNA. Indicate the amino (NH,*) andcarboxy (COO') termini of the protein

Name: 3. Shown below is a double-stranded bacterial (E. coli) DNA sequence
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 3. Shown below is a double-stranded bacterial (E. coli) DNA sequence coding for a hypothetical protein.Both strands are shown; the top strand reads 5' to 3' left to right, while the bottom strand reads 5' to 3'right to left. The nucleotides are numb