Both strands are shown; the top strand reads 5' to 3' left to right, while the bottom strand reads 5' to 3' right to left. The nucleotides are numbered 1 to 100. NOTE: For this problem, transcription begins with and includes the red and underlined CIG (top strand/bottom strand) base pair and RNA polymerase proceeds from left to right along the DNA. 1 20 40 5'-GTGTCCGTCTAАТАТТGTGAGATGTТАТАТСССGCСGTCAАCАССАТСАА-3' --+-- --- --- --- --- 3'-САСAGGCAGATTATAACAСТСТАСААТАТAGGGCGGCAGTTCTGGTAGTТ-5' 60 80 100 5'-ACAGGATAATCGCCTGCTGGGGCAAAGGCGGTGAAGGTAAAGGTGTTGCC-3' --+----- +--- -+-- ---+--- ----+ 3'-тстссТАтТAGCGGACGAСССССTTTCСGССАСТТССАТТтССАСААСGG-5' a) Which strand is used as a template for transcription, the top or the bottom? b) Where would the promoter be relative to the start of transcription? c) What are the first 15 nucleotides of the resulting mRNA? Indicate the 5' and 3' ends of the mRNA. d) What are the first 5 amino acids translated from the resulting mRNA? Indicate the amino acids translated from the resulting mRNA. Indicate the amino (NH,) and carboxy (COO') termini of the protein
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.


Trending now
This is a popular solution!
Step by step
Solved in 2 steps









