A DNA fragment with the following base sequence has some cytosine bases that are methylated (indicated by C*) and others that are unmethylated. To determine the locations of methylated and unmethylated cytosines, researchers sequenced this fragment both with and without treatment with sodium bisulfite. Give the sequence of bases that will be read with and without bisulfite treatment. —ATCGC*GTTAC*GTTGC*GTCA—

A DNA fragment with the following base sequence has some cytosine bases that are methylated (indicated by C) and others that are unmethylated. To determine the locations of methylated and unmethylated cytosines, researchers sequenced this fragment both with and without treatment with sodium bisulfite. Give the sequence of bases that will be read with and without bisulfite treatment. —ATCGCGTTACGTTGCGTCA—

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 14QP: State the properties of the WatsonCrick model of DNA in the following categories: a. number of...

See similar textbooks

Similar questions

How many kilobases of the DNA strand below will code for the protein product?
This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.
A geneticist is interested in determining the locations of methylated cytosines within a fragment of DNA. She treats some copies of the fragment with sodium bisulfite and leaves some copies untreated. She then sequences the treated and untreated copies of the fragment and obtains the following results. Give the original sequence of the DNA fragment and indicate the locations of methylated cytosines. Sequence without treatment: — AATTGCCCGATCGATTAAGCCA — Sequence with treatment: — AATTGTTTGATCGATTAAGCTA —
Given the sequence shown below, write the complementary DNA sequence, using the base-pairing rules, as well as the directionality of the strands: 5'- CGAGGCTAGGTTAACCTG-3'
A DNA strand was sequenced using the Sanger method (https://www.youtube.com/watch?v=KTstRrDTmWI). The reaction tube contained the DNA strand, fluorescently labelled dideoxynucleotide triphosphates (ddATP – yellow, ddGTP – green, ddCTP – blue, ddTTP - red), deoxynucleotide triphosphates, DNA polymerase, or its Klenow fragment. Synthesis of DNA is allowed to proceed, and the results are shown on the right: 15 14 13 12 11 10 (a) What is the sequence of the copy and the template strands? (b) If the template strand were in the 5'-3' direction, what will be the sequence of the DNA copy? Nucleotide Length
Using the codon table, identify a 5’-3’ sequence of nucleotides in the dna template strand for mRna coding for the polypeptide sequence NH2-PHe-Pro-lys-COOH.
The sequence of the coding strand of a bacterial gene is given below. The positions of the first nine bases are numbered for your convenience. A missense mutation was introduced at position seven where the C was changed to a T resulting a mutant gene. 123456789 5'- ATGGCCCGACCGCAACTTTTCCGAGCTCTGGTGTCTGCGCAGTGACC-3 a. Write the template DNA (complementary strand) sequence for the wild type gene above b. Write the DNA sequence of the mutant gene (Both DNA strands) c. Write the sequence of mRNA produced from the mutant gene d. Write the sequence of the mutant protein using the codon usage table provided in the end of this document.
Below is a short nucleotide sequence from a gene. Use the Internet(e.g., see www.ncbi.nlm.nih.gov/Tools) to determine what genethis sequence is from. Also, determine the species in which thisgene sequence is found. 5’–GGGCGCAATTACTTAACGCCTCGATTATCTTCTTGC GCCACTGATCATTA–3’
Write the sequence of reverse compliment chain to this DNA sequence: CGTCCGCCCCGCGAGCACA TGTGCGCGCGGGGCG
Identify the dinucleotide CA repeat region and the score in the following sequence:TGGCACACTCACACCACACAGACAGTTA
This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' Draw the structure of hairpin loop that will be formed during the end of transcription.
Given the DNA template strand 3' GCATTCAAG 5', write the amino acid sequence in the N‑terminal to C‑terminal direction. Note: Enter the amino acids using their three-letter designations. Put a hyphen between each amino acid.