The restriction endonuclease NciI recognizes and cuts the five-base-pair sequence 5’- CC(G/C)GG-3’ [where (G/C) means either G or C will work at that position]. (1) How often, on average, would this sequence occur in random DNA? Assume the DNA contains 25% each of A, G, T & C. (2) After digestion, Nci1 leaves a one-base 5’ overhang. Write/draw the cut site/digested products.

Q: Which RE’s from table below have a 5’ overhang? Which ones have a 3’ Overhang?   AccI GT^CGAC…

A: Restriction enzymes are the specific enzymes that recognize and cut at specific sites on nucleotide…

Q: scientist is interested in the amplification of a specific DNA fragment in a large plasmid of about…

A: The specific DNA sequence can be amplified by using primers in the polymerase chain reaction or PCR.…

Q: At a specific area of this chromosome, the sequence of nucleotides below is present where the chain…

A: The region of DNA known as the replication fork is where the replication process itself is now…

Q: When joining two or more DNA fragments, a researcher can adjust the sequence at the junction in a…

A: In molecular science, the control of DNA is central to numerous experiments and innovations,…

Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary…

A: Deoxyribonucleic acid (DNA) is a nucleic acid that carries genetic information from parent to…

Q: 1. Look at the cut DNA sequences shown below in i) and ii). a) What restriction enzyme(s) was/were…

A: To help you better understand the answers above, here are non-technical explanations of each…

Q: The restriction enzyme Alu I cleaves at the sequence 5’-AGCT- 3' , and Not I cleaves at 5'…

A: Restriction enzymes or restriction endonucleases are endonuclease enzymes capable of recognizing a…

Q: In a Sanger DNA sequencing reaction (dideoxy method) you use the primer 5′-GCATATA-3′ to sequence a…

A: Sequencing of DNA refers to the biochemical methods for determining the order of the nucleotide…

Q: People with lactose intolerance cannot digest the common dairy sugar lactose. Besides being careful…

A: Lactose intolerance is a digestive disorder caused by the inability to digest lactose, the main…

Q: In a random sequence consisting of equal proportions of all four nucleotides, what is the average…

A: Restriction enzymes are natural occurring enzymes which are mainly found in prokaryotic organisms. A…

Q: The following diagram shows one-half of a restriction site. (a) Draw the other half. GAC G I C (b)…

A: Introduction: The genetic material in the living organism that transfer from one generation to…

Q: A virus with a circular double-stranded DNA chromosome contains approximately 10,000 bp. You want to…

A: To construct a map of the viral chromosome based on the cleavage sites of the restriction…

Q: When circular DNA is sequenced, the nucleotide base pairs are numbered starting from a fixed…

A: It is related to molecular biology in which we use restriction enzymes an important tool for

Q: Although DNA polymerases require both a template and a primer, the following single-stranded…

A: DNA polymerases require both a template and a primer to synthesize DNA. However, some…

Q: A team of scientist is interested in the amplification of a specific DNA fragment in a large plasmid…

A: The specific DNA sequence can be amplified by using primers in the polymerase chain reaction or PCR.…

Q: A linear piece of DNA that is 14 kb long is cut first by EcoRI alone, then by SmaI alone, and…

A: Restriction enzymes are the endonucleases that digest the DNA at specific sites called restriction…

Q: The restriction endonuclease NotI recognizes the octanucleotide sequence GCGGCCGC. Calculate the…

A: Restriction endonucleases are enzymes that cut DNA sequences at a specific site known as a…

Q: How often, on average, will the endonuclease AluI, which cleaves the sequence 5’ AGCT 3’, cut normal…

A: Enzyme restriction, also referred to as endonuclease restriction, is a protein formed by bacteria…

Q: 5. The A DNA used for digestion was provided at a concentration of 2ug/ul. How much DNA (in…

A: DNA Should be free of contaminants such as phenol, chloroform, alcohol, EDTA, detergents or…

Q: Assume that a DNA sequencing reaction is carried out, except that the four different…

A: Ans: DNA sequencing: It is the process of knowing the sequence of the DNA. The DNA sequencing is of…

Q: Human genomic libraries used for DNA sequencing are often made from fragments obtained by cleaving…

A: Genomic Libraries are a set of collections of genomic DNA data particular to a species/organism. The…

Q: The DNA of a deletion of alpha bacteriophage has a length of 15 micrometers instead of 17…

A: The bacteriophage is those viruses that have the capability to infect bacteria and reproduce inside…

Q: The genomic DNA of an organism has a base composition of 60% C-G base pairs and 40% A-T base pairs.…

A: DNA stands for deoxyribonucleic acid. It is a genetic material. It is present in the nucleus and…

Q: Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic…

A: An exon is any part of a gene that will encode a part of the final mature RNA produced by that gene…

Q: D) Draw the first two (2) base pairings of the DNA molecule from the 5' end and label all key…

A: The self replicating biomolecules that are present in the chromosomes and carry genetic information…

Q: 9. (2) Here is a sequence of double stranded DNA. Choose a pair of primers to amplify gene X.…

A: Polymerase Chain reaction or PCR is a rapid in vitro technique for amplifying target DNA…

Q: All known DNA polymerases catalyze synthesis only in the 5' → 3' direction.  Nevertheless, during…

A: DNA replication is the process of making two identical copies of DNA. The process is carried by the…

Q: Consider the following coding sequence transcribed from 5' to 3' 5' A T G A A G C G C T C A G T A 3'…

A: Substitution of guanine at position 11 would result in to conversion of UCA into UGA (which is a…

Q: When linear DNA is sequenced, the nucleotide base pairs are numbered from the start to finish. a DNA…

A: DNA is the genetic material present in all living cells. It carries information from one cell to…

Q: The 3′ → 5′ exonuclease activity of Pol I excises only unpaired 3′-terminal nucleotides from DNA,…

A: A technique discovered by Kary Mullis, polymerase chain reaction (PCR), is used to replicate the DNA…

Q: A mixture of four a-[*p]-labeled ribonucleoside triphosphates was added to permeabilized bacterial…

A: (a)By adding in excess unlabeled rNTPs, the labeled rNTPs that were added previously will stop being…

Q: Given the partial transposons DNA sequence 5’-ACCGTATTCGGT-3’ upstream from the central region,…

A: Transposons are the regions in the DNA molecule that can change their position within the genome.…

Q: If the sequence of base pairs along a DNA molecule occurs strictly at random, what is the expected…

A: Introduction: The palindromic sequences that make up the restriction sites are where the restriction…

Q: In Polymerase Chain Reaction (PCR), the temperature is one of the most important parameters that…

A: Note:  As per the guidelines, the first question has been solved here. Please post the other…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.