The restriction endonuclease NciI recognizes and cuts the five-base-pair sequence 5’- CC(G/C)GG-3’ [where (G/C) means either G or C will work at that position]. (1) How often, on average, would this sequence occur in random DNA? Assume the DNA contains 25% each of A, G, T & C. (2) After digestion, Nci1 leaves a one-base 5’ overhang. Write/draw the cut site/digested products.

Q: scientist is interested in the amplification of a specific DNA fragment in a large plasmid of about…

A: The specific DNA sequence can be amplified by using primers in the polymerase chain reaction or PCR.…

Q: The BamH1 enzyme comes at a concentration of 100,000 U/ml. You are asked to digest 20 ug of DNA with…

A: The term "specific activity" describes the amount of an enzyme's enzymatic activity that is produced…

Q: At a specific area of this chromosome, the sequence of nucleotides below is present where the chain…

A: The region of DNA known as the replication fork is where the replication process itself is now…

Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary…

A: Deoxyribonucleic acid (DNA) is a nucleic acid that carries genetic information from parent to…

Q: Assume the following DNA template strand: 3'-ATA GCG AGG AGT ATC-5' A) What would be the protein…

A: Introduction  A mutation is a change in the structure of a gene, which is the fundamental unit of…

Q: In a Sanger DNA sequencing reaction (dideoxy method) you use the primer 5′-GCATATA-3′ to sequence a…

A: Sequencing of DNA refers to the biochemical methods for determining the order of the nucleotide…

Q: A virus with a circular double-stranded DNA chromosome contains approximately 10,000 bp. You want to…

A: To construct a map of the viral chromosome based on the cleavage sites of the restriction…

Q: A K I D H

A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. The structure of…

Q: Based on the sequence data in the figure above, would you consider the patient to be not affected,…

A: Based on the information provided in the figure above, it can be concluded that the patient is…

Q: Although DNA polymerases require both a template and a primer, the following single-stranded…

A: DNA polymerases require both a template and a primer to synthesize DNA. However, some…

Q: A team of scientist is interested in the amplification of a specific DNA fragment in a large plasmid…

A: The specific DNA sequence can be amplified by using primers in the polymerase chain reaction or PCR.…

Q: The restriction endonuclease NotI recognizes the octanucleotide sequence GCGGCCGC. Calculate the…

A: Restriction endonucleases are enzymes that cut DNA sequences at a specific site known as a…

Q: How often, on average, will the endonuclease AluI, which cleaves the sequence 5’ AGCT 3’, cut normal…

A: Enzyme restriction, also referred to as endonuclease restriction, is a protein formed by bacteria…

Q: 5. The A DNA used for digestion was provided at a concentration of 2ug/ul. How much DNA (in…

A: DNA Should be free of contaminants such as phenol, chloroform, alcohol, EDTA, detergents or…

Q: Assume that a DNA sequencing reaction is carried out, except that the four different…

A: Ans: DNA sequencing: It is the process of knowing the sequence of the DNA. The DNA sequencing is of…

Q: Human genomic libraries used for DNA sequencing are often made from fragments obtained by cleaving…

A: Genomic Libraries are a set of collections of genomic DNA data particular to a species/organism. The…

Q: The genomic DNA of an organism has a base composition of 60% C-G base pairs and 40% A-T base pairs.…

A: DNA stands for deoxyribonucleic acid. It is a genetic material. It is present in the nucleus and…

Q: Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic…

A: An exon is any part of a gene that will encode a part of the final mature RNA produced by that gene…

Q: D) Draw the first two (2) base pairings of the DNA molecule from the 5' end and label all key…

A: The self replicating biomolecules that are present in the chromosomes and carry genetic information…

Q: You are studying a protein that contains the peptide sequence RDGSWKLVI. The part of the DNA…

A: The restriction endonuclease are responsible for cutting the DNA at specific sequence and they…

Q: 9. (2) Here is a sequence of double stranded DNA. Choose a pair of primers to amplify gene X.…

A: Polymerase Chain reaction or PCR is a rapid in vitro technique for amplifying target DNA…

Q: Show the expected labeled cleavage products if the following DNA segment were subjected to each of…

A: D.N.A. Cleavage ---  A cleavage of single - stranded DNA oligonucleotides in the presence of ionic…

Q: Consider the following coding sequence transcribed from 5' to 3' 5' A T G A A G C G C T C A G T A 3'…

A: Substitution of guanine at position 11 would result in to conversion of UCA into UGA (which is a…

Q: DNA Polymerase Holoenzyme Il is represented below. It consists of several domains with distinct…

A: At the replication fork, DNA polymerase III holoenzyme (Pol III HE) works with the helicase and…

Q: When linear DNA is sequenced, the nucleotide base pairs are numbered from the start to finish. a DNA…

A: DNA is the genetic material present in all living cells. It carries information from one cell to…

Q: Draw the double-stranded sequence of each fragment after cleavage showing any phosphates left on the…

A: Restriction endonucleases cut double stranded DNA at specific site or near specific site and form…

Q: For the following sequence, what is the Tm? 5'-AGCTACGATCAGGTCA-3'

A: Polymerase chain reaction (PCR) is a technique to amplify the sequence of DNA. A large quantity of…

Q: In Polymerase Chain Reaction (PCR), the temperature is one of the most important parameters that…

A: Note:  As per the guidelines, the first question has been solved here. Please post the other…

Q: Each of the following pairs of primers has a problem with it. Tell why the primers would not work…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: For the DNA sequence shown, indicate the products of its cleavage with the following restriction…

A: In the field of molecular biology and genetic engineering, restriction enzymes, commonly referred to…

Q: The restriction enzymes KpnI and Acc65I recognize and cleave the same 6-bp sequence. However, the…

A: To answer this question we should have knowledge of Biotechnology

Q: By average, how many Sau3A (5’GATC3’) sites are there in a 10 kd DNA molecule? (1/4)^6 * 10,000 =…

A: Answer :- For the first question, the restriction site for the enzyme Sau3a is composed of four…

Q: In the human genome for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood…

A: Hemoglobin present in red blood cells helps in the transport of oxygen molecule to and from various…

Q: What part(s) of a nucleotide (namely, phosphate, sugar, and/orbase) is(are) found in the major and…

A: Nucleotides are composed of a phosphate group, a pentose sugar, and a nitrogenous base. The pentose…

Q: A hypothetical map of a 10,000 bp (base pair) segment of a human chromosome is shown (1 kbp= 1,000…

A: In this experiment, DNA from two different individuals, Individual 1 and Individual 2, is extracted…

Q: our raw sequencing data, from two reactions, are given: 5'-ACCGTCGGTTACGCTTAGA-3'…

A: A) One Sequence Read as per data: GTTACGCTTAGA B) One Sequence Contig: ACCGTCGGTTACGCTTAGATAACAAG

Q: Problem 1: a) Given the strand of the DNA sequence below, REPLICATE its complimentary DNA partner…

A: DNA replication is described as process in which the double stranded DNA molecule is copied into two…

Q: 5’-GATCAGCTGACTGGATCCGTCCTCAACGTCAGGATCCAGCTTCAAG-3’ 1. How many cuts do you expect this enzyme to…

A: Some enzymes are called endonucleases cleave the phosphodiester bonds that exist in the DNA. Some…

Q: A 2.0kb bacterial plasmid ‘BS1030’ is digested with the restriction endonuclease Sau3A; the plasmid…

A: Plasmids are small, circular, double stranded, and extrachromosomal bacterial DNA. i.e. it is…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.