Given the partial transposons DNA sequence 5’-ACCGTATTCGGT-3’ upstream from the central region, assuming both terminal inverted repeats and flanking direct repeats have 6 base pairs, hypothetically write the transposon structure downstream from the central region.

Q: Why are eukaryotic polyribosomes circular?  Check all that apply. Only mRNAs that are bound to…

A: Polyribosomes, clusters of ribosomes translating an mRNA molecule, are crucial for protein synthesis…

Q: Recombination signal sequences are conserved heptamer and nonamer sequences that flank the V, J, and…

A: Introduction: RAG 1 & 2 are the recombination activating genes that encode a portion of a…

Q: Cells normally repair the lesion O-methylguanine (0°-meG) by directly transferring the methyl group…

A: Solution:This image presents a question about DNA repair, specifically the repair of…

Q: determine if the individual is homozygous for presence of the Alu insertion(++), heterozygous (+-),…

A: Each Alu sub family member assertion locus was assayed by PCR analysis. It is done by using…

Q: A eukaryotic gene has two introns and three exons. The first intron closest to the promoter is 157…

A: To draw the structure of the hybridized mRNA and estimate the size of the protein coded for by this…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: Calculate the expected number of times that a given 8-base-pair DNA site should be present in the E.…

A: A bacterial genomic DNA resides inside cells in a highly condensed and functionally organized form…

Q: Telomeres contain a 3′ overhang region, as shown. Does telomerase require a 3′ overhang to replicate…

A: Telomeres are protein complexes placed at chromosome ends. The specific telomere structure covers…

Q: Human genomic libraries used for DNA sequencing are often made from fragments obtained by cleaving…

A: Genomic Libraries are a set of collections of genomic DNA data particular to a species/organism. The…

Q: The DNA of a deletion of alpha bacteriophage has a length of 15 micrometers instead of 17…

A: The bacteriophage is those viruses that have the capability to infect bacteria and reproduce inside…

Q: For insertion elements and simple transposition, what is the function of the inverted repeat…

A: Transposition A transposon also called a jumping gene is the DNA sequence that changes its position…

Q: Although DNA transposons are abundant in the genomes of multicellular eukaryotes, class 1 elements…

A: The transposable elements are sequences which keeps on changing their position in the human genome,…

Q: The E. coli genome contains approximately 4639 kb. (a) How many copies of the 6-bp recognition…

A: E.coli is a type of bacteria that normally lives in the intestine. It is also found in the gut of…

Q: Ladder LS KT MV DY JY Ladder 850 bp 550 bp 11 1

A: Gel electrophoresis is the technique that is used to determine the genotype by looking at the…

Q: If the bandicoot genome is 3.62 x 109 base pairs, and the "highly repetitive DNA" fraction is…

A: The genome is the entire DNA content (in base pair) of a haploid (n) cell. That means in case of a…

Q: The restriction endonuclease NciI recognizes and cuts the five-base-pair sequence 5’- CC(G/C)GG-3’…

A: Introduction: A bacterial protein termed restriction enzyme, also known as restriction endonuclease,…

Q: Some RNA molecules are covalently modifi ed by methylation at the N6 position in adenosine residues.…

A: Methylation of DNA is a process of covalent modification, in which at the adenosine nitrogenous…

Q: our raw sequencing data, from two reactions, are given: 5'-ACCGTCGGTTACGCTTAGA-3'…

A: A) One Sequence Read as per data: GTTACGCTTAGA B) One Sequence Contig: ACCGTCGGTTACGCTTAGATAACAAG

Q: solution containing single stranded DNA with the sequence 5’ATGGTGCACCTGACTCCTGAGGAGAAGTCTNNNNN’3…

A: In this reaction, we have used dideoxyadenosine triphosphate. Hence, the reaction will stop at all…

Q: Look at the sequence of TAS2R38 (Fig. 4.10 of your module and below). The numbers at the beginning…

A: In molecular biology, DNA sequences are the blueprint of life, encoding the instructions for…

Q: When the cDNA was sequenced by the Sanger method utilizing ddCTP, the following products were…

A: Answer :: If the dCTP was not present, the polymerization would come to a standstill, resulting…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.