4. Within this double-stranded segment of DNA, there is a protein-coding region for a gene. 3'-AATATGACGTCAGTAGA-5' CODING STRAND ||| || || | || || || | || 5'-TTATACTGCAGTCA TCT-3' a. Identify on which strand the gene begins. Draw a box around the start codon. (1 pt) b. Which strand will RNA polymerase follow when it transcribes the gene? (.5 pts) c. In what direction will it transcribe? Draw an arrow above or below the DNA strands to indicate. (0.5 pts) d. Write the RNA sequence that would be transcribed below. (1 pt)

Q: 1. For the DNA molecule shown below, the 3' Strand of DNA is transcribed into mRNA and then…

A: The creation of proteins from the hereditary data stored in DNA depends on the processes of…

Q: Below is a sample of a segment of DNA…(copy from left to right)   3’…

A: Mutation  It occurs when a DNA gene is changed in such a way as to alter the genetic message carried…

Q: Answer the following:  DNA fragment A is 3' AGC CCG CTC CGA GGC TAA AAG CGT 5' 1. is % of guanine…

A: The central dogma of life is that DNA self replicates to form its own copies. The copied DNA is…

Q: 5’-GTCGTATAGTGA-3’ 3’-CAGCATATCACT-5’ What does the newly formed RNA sequence look like if the RNA…

A: DNA forms a double-helix in which two antiparallel strands are wound around each other. The two…

Q: What is the mRNA coded by this template DNA strand? DNA Template Strand: 3' ATGGTACGGTCG 5'…

A: A codon is known to code by three different types of bases in a particular mRNA. Hence, a codon is…

Q: Match the features to the labeled parts (Some may be used mutliple times, and not all labeled names…

A: Answer. A -  N terminus- A polypeptide synthesis proceeds from N- terminus to C-terminus and…

Q: 2. Given a DNA template molecule of 5'- ATGGCTCCTACCTACTAGTTAACATATGG-3', generate the mRNA sequence…

A: We are given a sequence of DNA in 5'-3' direction.  We have to generate the mRNA sequence and then a…

Q: Give the corresponding strand of the DNA having the sequence of: a. 5’…

A: DNA(deoxyribonucleic acid) is the heredity material for most living organisms. It is composed of…

Q: 5'AGGCTCCAGG 3' Which complementary RNA strand can be made from this sequence? Select one: O a. 5'…

A: formation of m RNA from DNA is called transcription. RNA polymerase synthesizes m RNA by adding…

Q: 4. The template strand from the previous question is mutated to the DNA sequence shown below: 3' GTC…

A: transcription is the process by which messenger rna is made from dna .

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: 1. The below strand is a normal polypeptide. Using the below base sequence and amino acids, draw an…

A: AMINO ACIDS --These are the organic molecules ,structural which make up the proteins .The proteins…

Q: The following is a section of DNA removed from a cell nucleus: 5'…

A: The basic physical and functional unit of heredity is the gene. DNA is the material that makes up…

Q: 1. The nontemplate strand of a segment of double- helical DNA contains the sequence:…

A: Since you have posted a question with multiple sub-parts, we will solve the first 2subparts for you.…

Q: TAC CTA CTC TAG TTA ACCACA GTT GCCATC Transcribe the given template strand of DNA:I Second mRNA base…

A: The Genetic code is  :  1. Universal 2. Redundant 3.Non Ambiguous Genetic Codon have start and stop…

Q: E 64 In the figure shown below, which of the DNA strands is the template strand, upper or lower?…

A: Ans- The template strand of the DNA serves as a template for synthesis of a complementary RNA…

Q: (a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT…

A: Introduction :- Mutations are the hereditary changes that occurs in the Genetic material (DNA) of…

Q: b. You have found two mutant alleles of Gene A that have insertion of the three base pairs (as shown…

A: DNA is the deoxyribonucleic acid. It is a double-stranded molecule, which consists of two strands:…

Q: DNA Leading strand: 5' AAA ATA | CGC TTT| TTA ATT | AAC CCC GGG 3' A I B |C| D Exons: A, C, D…

A: The process of synthesizing RNA from the genetic information encoded by DNA is called Transcription…

Q: Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA…

A: The core dogma notes that the sequence of learning most commonly found in our cells is: From…

Q: 48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of…

A: The antisense DNA sequence is - 5' GGACCCTAT 3' The single nucleotide deletion can occur at any…

Q: The following sequence is a double stranded DNA.…

A: The promoter region is a crucial segment of DNA located upstream (in the 5' direction) of a gene…

Q: ow many amino acids will the mRNA sequence "AUG GAC CUG UCG A" produce? (LS1-1) *

A: Amino acids production.

Q: 25. Which sequence includes RNA that's complementary to the DNA sequence 5'-TATTCGC-3'? (Hint: in…

A: Adenine(A) and guanine(G) are purines ; cytosine(C) and thymine(T)/uracil(U) are pyrimidines , both…

Q: 1. Explain why DNA fragments can be separated using an electric current. How does the size of the…

A: 1.DNA fragments can be separated by the application of current this process of separating DNA occurs…

Q: The sequence of mRNA made using the DNA double helix shown below is (Select ] The sequence of…

A: Introduction Protein synthesis is a two step process. In the first step, a molecule of mRNA is…

Q: a) The following nucleotide sequence is found on the template strand of DNA: 3' - TAC TGG CCG TTA…

A: We are answering four parts  For rest of parts pls repost.

Q: It is a large complex ribonucleoprotein particle that chemically modifies the pre mRNA strand by the…

A: A ribonucleoprotein (RNP) is a complex of ribonucleic acid and RNA-binding protein.

Q: The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains…

A: The AUC and AUA codons in mRNA both specify isoleucine. This feauture of the genetic code explains…

Q: .  Locate the -10 region hexanucleotide sequence in the following coding strand of DNA.  Indicate…

A: Transcription is a process through which the template strand of the DNA transcribes into mRNA in the…

Q: What type of mutation is shown in the diagram?   Why do you think this type of mutation is referred…

A: Mutations are alterations in the gene sequence due to presence or interference of certain mutagenic…

Q: 6). What is the relationship (if any) between the following strand and the strands shown in sections…

A: DNA-Deoxyribonucleic acid  is a molecule that contains genetic information for the development for…

Q: Part of a gene is written below, and transcription begins at the boxed T/A base pair and proceeds…

A: Gene is present on a chromosome and contains hereditary information. These genes are later…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: The arrow in the diagram below indicates the direction of transcription. A BTTT…

A: Q. Ans:- The given image shows the process of transcription. Transcription:- Transcription is a…

Q: What are the correct codons of the MRNA from the given DNA strand th needs to be transcribed? *…

A: Sense strand It is also called as the coding strand , plus strand or the non template strand. The…

Q: 5' - ATG GGG CCC GTT TTC AAT ATG CAG GTC CAT CCG TAC GTA CAG GCC GGA ATT TGA - 3'   There are two…

A: Introns are the intervening or noncoding sequence present between the coding sequence.

Q: 29/ 50 Which of the following sms matched A Splicing: Eukaryotic premRNA B Lagging strand Okazaki…

A: Introduction: Ribonucleic acid (RNA) is a nucleic acid that has structural similarities to DNA and…

Q: transcription process of a prokaryotic gene. Redraw the diagram and label parts (i) to (v) on the…

A: Since there are multiple questions in this particular question, I'll answer the first three subparts…

Q: Could you please answer the part of the question where they ask you to motivate your answers?

A: A transcription bubble is a chemical structure that forms when a little piece of the DNA…

Q: Which strand below would be the complementary strand for the sequence AAACGCTT O GGGTATCC O AAGCGTTT…

A: A "nucleic acid" is a linear polymer of nucleotides that is a component of the cell's information…

Q: Fill in the chart and answer the two questions at the bottom of the picture.

A: Transcription is a process in which RNA is synthesized with the help of RNA polymerase enzyme using…

Q: AUGCCGCAAUCUGUUCACGCACUCAUGUG TII CAC & CACICATETE Direction of synthesis- BTTT ATGCCGCA сш TTT…

A: The term "mRNA" is defined as a single-stranded molecule that carries genetic code from DNA used to…

Q: 1. The nontemplate strand of a segment of double- helical DNA contains the sequence:…

A: DNA => Transcription => mRNA => Translation => Protein. Given : Non-template strand…

Q: . What is the nucleotide sequence of the complementary strand of the DNA molecule:…

A: DNA or deoxyribose nucleic acid is the genetic material for most organisms. It is a polymer of…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.