4. Within this double-stranded segment of DNA, there is a protein-coding region for a gene. 3'-AATATGACGTCAGTAGA-5' CODING STRAND ||| || || | || || || | || 5'-TTATACTGCAGTCA TCT-3' a. Identify on which strand the gene begins. Draw a box around the start codon. (1 pt) b. Which strand will RNA polymerase follow when it transcribes the gene? (.5 pts) c. In what direction will it transcribe? Draw an arrow above or below the DNA strands to indicate. (0.5 pts) d. Write the RNA sequence that would be transcribed below. (1 pt)

4. Within this double-stranded segment of DNA, there is a protein-coding region for a gene. 3'-AATATGACGTCAGTAGA-5' CODING STRAND ||| || || | || || || | || 5'-TTATACTGCAGTCA TCT-3' a. Identify on which strand the gene begins. Draw a box around the start codon. (1 pt) b. Which strand will RNA polymerase follow when it transcribes the gene? (.5 pts) c. In what direction will it transcribe? Draw an arrow above or below the DNA strands to indicate. (0.5 pts) d. Write the RNA sequence that would be transcribed below. (1 pt)

Name: 4. Within this double-stranded segment of DNA, there is a protein-cod
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 4. Within this double-stranded segment of DNA, there is a protein-coding region for agene.3'-AATATGACGTCAGTAGA- 5' CODING STRAND||| || || | || ||||| ||5'-TTATACTGCAGTCA TCT-3'a. Identify on which strand the gene begins. Draw a box around the startco

Biology: The Unity and Diversity of Life (MindTap Course List)

14th Edition

ISBN:9781305073951

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter9: From Dna To Protein

Section: Chapter Questions

Problem 1SQ: A chromosome contains many different genes that are transcribed into different ___ . a. proteins b....

See similar textbooks

Similar questions

DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’a. what is the non-template/sense/coding strand?b. What is the arrangement of the m-RNA?c. What's the chain arrangement of the amino acids that will be made according to the order of the RNA?d. If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed?e. What's the chain arrangement of the amino acids produced by this mutation?
5' - ATG GGG CCC GTT TTC AAT ATG CAG GTC CAT CCG TAC GTA CAG GCC GGA ATT TGA - 3' There are two introns in this DNA sequence. Remember introns start with GT and end with AG. (a) How many base pairs are in intron 1 and intron 2.
5'-GCGGTACGTTACGGCTTTACTGACCTGCAGGC-3' A. Convert this to a double strand DNA molecule by writing the complementary sequence. Be sure to correctly label the ends of the double stranded molecule B. Pick one of the two strands and write the sequence of an RNA molecule that could be transcribed from it. Again, you must correctly label the ends of the molecule.
Isein) are shówn in the following document: Codon Number Base Sequence of Normal DNA Transcribed Strand ТАС ТСС СТС AAT СТ AAT TTG Base Sequence of Abnormal DNA Transcribed strand ТАС ТСС СТС AAT CTT ATT TTG 7. Compare the 2 DNA sequences and explain the absence of functional casein in abnormal females.
Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…
1. The nontemplate strand of a segment of double- helical DNA contains the sequence: (5')CGCTATAGCGTTTAG (3') (a) What is the MRNA base sequence that can be transcribed from this double helical DNA assuming you already have a ready RNA polymerase present and everything else needed for RNA transcription? Label the sequence ends and list what is required for RNA Pol to work. (b) What amino acid sequence could be coded by the MRNA in (a)'s answer assuming the AUG start codon is just upstream of the MRNA (not shown in the sequence provided)? Use table in Figure 27-7 of the Lehninger 7 th ed "Dictionary of amino acid code words in mRNAs" and write the peptide according to standard convention with abbreviations for the amino acids. (c) If the wrong strand was transcribed and then translated from the section of double stranded DNA shown above, what would the resulting amino acid sequence be? What would the mRNA sequence be? Explain your answer and label all strands. A. First letter of codon…
1. The nontemplate strand of a segment of double- helical DNA contains the sequence: (5')CGCTATAGCGTTTAG (3') (a) What is the MRNA base sequence that can be transcribed from this double helical DNA assuming you already have a ready RNA polymerase present and everything else needed for RNA transcription? Label the sequence ends and list what is required for RNA Pol to work. (b) What amino acid sequence could be coded by the mRNA in (a)'s answer assuming the AUG start codon is just upstream of the MRNA (not shown in the sequence provided)? Use table in Figure 27-7 of the Lehninger 7 th ed "Dictionary of amino acid code words in mRNAs" and write the peptide according to standard convention with abbreviations for the amino acids. (c) If the wrong strand was transcribed and then translated from the section of double stranded DNA shown above, what would the resulting amino acid sequence be? What would the MRNA sequence be? Explain your answer and label all strands. 歐歐队相阳阳一即即的 9 First letter…
Answer the following whether it is TRUE or FALSE: 1. For each DNA segment 3'-ACCTGCCTACCCG-5' the sequence of the mRNA molecule synthesized is 5'-TGGACGGATGGGC-3' 2. In the template strand TACCGAGGTATGTAC, the coding strand is 5'-ATGGCTCCATACATG-3'. 3. In the template strand TACCGAGGTATGTAC, the coding strand is 5'-AUGGCUCCAUACAUG-3'. 4. The template strand is the strand of DNA used for RNA synthesis. 5. Transcription forms a messenger RNA molecule with a sequence that is identical to the DNA template from which it is prepared.
a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG..... TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: b. Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. polypeptide sequence: does the sense strand DNA sequence have 5’ and 3’ UTR sequences? 5'UTR = 3'UTR =
The following is a section of DNA removed from a cell nucleus:5' ATGAAATAATCAGTTAACAGCAGVFCCGATTTTTATACT 3'strand 3' TACITTATTAGTCAAVFGTCGTCAAGGCTAAAAATATGA 5'strand a. What does the Central Dogma state? b. Label the strands above as the "sense" or "antisense" strand. c. Using the chart below, transcribe ONLY the gene into mRNA and then translate the gene into its amino acid sequence, d. What would happen to the gene if the adenosine mutates to a thymine where the arrow indicates? 3' TACTTTATTAGTCAATTGTCGTCAAGGCTAAAAATATGA 5' What type of mutation is this?
1. Cytosine deamination, in which cytosine is mutated to uracil, occurs spontaneously in DNA at a rate of 1 out of 107 cytosines in 24 hours. tofo NH₂ 'N cytosine deamination ----ဝိ NH spr a. If cytosine deamination occurs and DNA polymerase replicates the DNA with this altered base, what mutation would be introduced into DNA? b. Cytosine deamination is so common that DNA repair enzymes recognize uracil and replace it with cytosine. Given this information, why is it essential for DNA, the carrier of the genetic blueprint, to utilize thymine, not uracil, as a base?
8. You have a piece of DNA with the sequence shown below. 5-AAAGTCGCTGGAATTCACTGCATCCCCGGGGCTATATATGAATTCGATGCGTACTTGGCACG-3' 3'TTTCAGCGACCTTAAGTGACGTAGGGGCCCCGATATATACTTAAGCTACGCATGAACCGTGC-5' You cut this fragment with the restriction enzyme EcoRI. The recognition site for EcoRI is 5-GAATTC-3' 3-CTTAAGS" EcoRI cuts at the site and in the manner indicated by the arrows to yield fragments with overhanging ends. 3-СТТААG-5' 5'G AATTC-3' 3-СТТАА G-5' Draw an illustration showing how the piece of DNA is cut by EcoRI and how many fragments result. Show all the base pairs and the overhanging ends at the ends of the DNA fragments.