3. DNA polymerase made a mistake and added a C on the DNA template strand. In the space on the mRNA sequence below, write the added base. (Remember that the DNA template and mRNA are complementary. Mark the codons again and write the amino acid sequence beneath them. What do you observe? (5') CGUUACAAUGUAU_CGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA 3' On this mRNA codon table, the first nucleotide in codon is to the left, the second is above, and third is to the right. the omingood tRNA U U Phe Phe Leu C Ser Ser Ser A G Tyr Cys U Tyr C Cys STOP STOP A

Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:Elaine N. Marieb, Katja N. Hoehn
Chapter1: The Human Body: An Orientation
Section: Chapter Questions
Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...
icon
Related questions
Question
**Transcription and Explanation for Educational Website**

**3. DNA polymerase made a mistake and added a C on the DNA template strand.** 

- mRNA Sequence: (This sequence is to be written complementarily to the DNA template, but with the addition of the 'C'.)
  
  `5' CGUUACAAGUAU_CGCGCGGUACUCGGCAAAGUGCCCUCAAUAGAGUUGGUA 3'`

**Task:** Write the added base on the mRNA sequence, mark the codons again, and write the amino acid sequence beneath them.

**Observation:**

- Using the mRNA codon table provided:

  - On this **mRNA codon table**, the first nucleotide in the codon is on the left, the second is above, and the third is to the right. This table is used to translate mRNA sequences into amino acids.

**4. A mutation in the gene encoding the aminoacyl tRNA synthetase for valine (VAL) causes the tRNA binding site to have the wrong shape.**

- In its new (mutant) shape, the enzyme can bind tRNAs for VAL and leucine (LEU) (not at the same time but enzymes work fast, and there are many of them).

  a. **Question:** In cells with this mutant tRNA synthetase, will the protein product of translation match the original one you deduced in question 2? 

     - **Circle one: (YES / NO).**
  
  b. **If not, how does it differ?**
  
  c. **Question:** How many different versions of the short polypeptide will exist in this mutant cell?

**Graph/Diagram Explanation:**

The diagram includes an mRNA codon table showing the translation of mRNA codons into amino acids. Each row corresponds to the first nucleotide, each column to the second, and within the box, options for the third nucleotide are shown. Amino acids are abbreviated (e.g., Phe for Phenylalanine, Val for Valine).

This assignment requires students to consider the effects of a mutation on protein translation and explore how reading the codon table allows for the determination of the resulting polypeptide sequence.
Transcribed Image Text:**Transcription and Explanation for Educational Website** **3. DNA polymerase made a mistake and added a C on the DNA template strand.** - mRNA Sequence: (This sequence is to be written complementarily to the DNA template, but with the addition of the 'C'.) `5' CGUUACAAGUAU_CGCGCGGUACUCGGCAAAGUGCCCUCAAUAGAGUUGGUA 3'` **Task:** Write the added base on the mRNA sequence, mark the codons again, and write the amino acid sequence beneath them. **Observation:** - Using the mRNA codon table provided: - On this **mRNA codon table**, the first nucleotide in the codon is on the left, the second is above, and the third is to the right. This table is used to translate mRNA sequences into amino acids. **4. A mutation in the gene encoding the aminoacyl tRNA synthetase for valine (VAL) causes the tRNA binding site to have the wrong shape.** - In its new (mutant) shape, the enzyme can bind tRNAs for VAL and leucine (LEU) (not at the same time but enzymes work fast, and there are many of them). a. **Question:** In cells with this mutant tRNA synthetase, will the protein product of translation match the original one you deduced in question 2? - **Circle one: (YES / NO).** b. **If not, how does it differ?** c. **Question:** How many different versions of the short polypeptide will exist in this mutant cell? **Graph/Diagram Explanation:** The diagram includes an mRNA codon table showing the translation of mRNA codons into amino acids. Each row corresponds to the first nucleotide, each column to the second, and within the box, options for the third nucleotide are shown. Amino acids are abbreviated (e.g., Phe for Phenylalanine, Val for Valine). This assignment requires students to consider the effects of a mutation on protein translation and explore how reading the codon table allows for the determination of the resulting polypeptide sequence.
Expert Solution
trending now

Trending now

This is a popular solution!

steps

Step by step

Solved in 3 steps

Blurred answer
Knowledge Booster
Virus
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:
9780134580999
Author:
Elaine N. Marieb, Katja N. Hoehn
Publisher:
PEARSON
Biology 2e
Biology 2e
Biology
ISBN:
9781947172517
Author:
Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:
OpenStax
Anatomy & Physiology
Anatomy & Physiology
Biology
ISBN:
9781259398629
Author:
McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:
Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:
9780815344322
Author:
Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:
W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:
9781260159363
Author:
Martin, Terry R., Prentice-craver, Cynthia
Publisher:
McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Inquiry Into Life (16th Edition)
Biology
ISBN:
9781260231700
Author:
Sylvia S. Mader, Michael Windelspecht
Publisher:
McGraw Hill Education