2. For the DNA molecule shown below, the 5' Strand of DNA is transcribed into mRNA and then translated into protein. Indicate the correct mRNA and protein sequences in the spaces provided. (Note: spaces were added to make sequences line up for 5' and 3' strands-they do not indicate a "missing" base) DNA 5'GCTTGATCAGCTAGTCCATC GATCGGTCCTCGGAGCCCATTAAGGTAGC 3' DNA 5' 3'CGAACTAGTCGATCAGGTAGCTAGCCAGGAGCCTCGGGTAATTCCATCG mRNA 5' Protein ALA A Alanine Arginine R ARG Aspartic Acid ASP D Asparagine ASN N Cysteine Glycine Glutamic Acid Glutamine Histidine Isoleucine Leucine Lysine CYS с G GLY GLU E GLN Q HIS H ISE I LEU L LYS K Methionine MET M Phenylalanine PHE F PRO P Proline Serine SER S Threonine THR T Tyrosine TYR Y Tryptophan TRP W Valine VAL V First letter U UUU Phenyl- UUC alanine Leucine UUA UUG CUU CUC CUA CUG AUU AUC Isoleucine AUA AUG GUU GUC Leucine GUA GUG Methionine; start codon Valine UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Second letter Serine Proline Threonine Alanine UAU UAC Tyrosine UAA Stop codon UAG Stop codon CAU CAC CAA CAG AAU AAC Histidine Glutamine GAA GAG Asparagine AAA AAG Lysine GAU Aspartic GAC acid Glutamic acid G UGU UGC Cysteine UGA Stop codon A UGG Tryptophan G CGU CGC CGA CGG AGU AGC GGU GGC Arginine AGA AGG Arginine GGA GGG Serine 3' Glycine UCA CAG SCAO Third letter
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.


Trending now
This is a popular solution!
Step by step
Solved in 3 steps









