2. For the DNA molecule shown below, the 5' Strand of DNA is transcribed into mRNA and then translated into protein. Indicate the correct mRNA and protein sequences in the spaces provided. (Note: spaces were added to make sequences line up for 5' and 3' strands-they do not indicate a "missing" base) DNA 5'GCTTGATCAGCTAGTCCATC GATCGGTCCTCGGAGCCCATTAAGGTAGC 3' DNA 5' 3'CGAACTAGTCGATCAGGTAGCTAGCCAGGAGCCTCGGGTAATTCCATCG mRNA 5' Protein ALA A Alanine Arginine R ARG Aspartic Acid ASP D Asparagine ASN N Cysteine Glycine Glutamic Acid Glutamine Histidine Isoleucine Leucine Lysine CYS с G GLY GLU E GLN Q HIS H ISE I LEU L LYS K Methionine MET M Phenylalanine PHE F PRO P Proline Serine SER S Threonine THR T Tyrosine TYR Y Tryptophan TRP W Valine VAL V First letter U UUU Phenyl- UUC alanine Leucine UUA UUG CUU CUC CUA CUG AUU AUC Isoleucine AUA AUG GUU GUC Leucine GUA GUG Methionine; start codon Valine UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Second letter Serine Proline Threonine Alanine UAU UAC Tyrosine UAA Stop codon UAG Stop codon CAU CAC CAA CAG AAU AAC Histidine Glutamine GAA GAG Asparagine AAA AAG Lysine GAU Aspartic GAC acid Glutamic acid G UGU UGC Cysteine UGA Stop codon A UGG Tryptophan G CGU CGC CGA CGG AGU AGC GGU GGC Arginine AGA AGG Arginine GGA GGG Serine 3' Glycine UCA CAG SCAO Third letter

Q: 1. For the DNA molecule shown below, the 3' Strand of DNA is transcribed into mRNA and then…

A: The creation of proteins from the hereditary data stored in DNA depends on the processes of…

Q: E D A 11. Ligase is denoted by letter 12. The Okazaki fragment is denoted by letter . 13. The SSB…

A: DNA (Deoxyribonucleic acid) and RNA are two examples of nucleic acids (Ribonucleic acid).…

Q: Draw a double-stranded DNA molecule (using different colors for each) model should clearly represent…

A: A G T A C C G G G C A A the sequence of DNA

Q: functions. The structure that provides high processivity (processivity factor) is represented by the…

A: Letter A denotes core polymerase enzyme B denotes tau protein C denotes gamma clamp loader D denotes…

Q: DNA duplication TAT GCA CTA ATA TAT GCA [triplets] ____ ____ ____ ____ _____ ____ Protein synthesis,…

A: The process of duplicating or replicating the given template stand DNA is called replication. Next…

Q: 2. Dr. Kim at Research Center performed shotgun Sanger sequencing on an unknown DNA sample, and…

A: In conventional sequencing method, in a reaction mixture,  single-stranded molecules of the DNA,…

Q: 7 a-d. i. ii. Draw the Hydrogen bonds between the base pairs and label the atoms that participate in…

A: There are 2 conventional base pairs in DNA. They are; Between Adenine and Thymine Between Guanine…

Q: 1. Complete the structure of this section of a DNA molecule. Label each base (A.I,G,C), sugar (S)…

A:

Q: 1. On paper, write out the first 30 bases in the middle of the page in order.  You want ensure you…

A: Disclaimer: "According to the guidelines of bartleby, only one question is to be answered. Please…

Q: Which of the following descriptions of regions A, B, and Care INCORRECT? A = minor groove, sugar…

A: On one side of the helix, the strand backbones are closer together than on the other. When the…

Q: What is the Complimentary DNA Strand to CGTCAGCAGACGAAAGGGCTTGCGGCGCGC. What is the content of CG in…

A: To find the complementary DNA (cDNA) strand, we need to identify the base pairs for each nucleotide…

Q: 3. Primer Design You are analyzing the

A: Primer is a short stretch of oligonucleotide which is designed to copy the gene sequence of interest…

Q: Draw double-stranded DNA (two basepairs long with one AT basepair and one GC basepair). Your drawing…

A: Basic structure of DNA and the structure of different nitrogenous bases.

Q: Which of the following molecules is a nitrogen base that would be found in 1 po DNA? (check all that…

A:

Q: Match each example of non-coding DNA sequences with its definition. Each answer may be used only…

A: Introduction  DNA (deoxyribonucleic acid) is a molecule that carries the genetic instructions used…

Q: 1. Written below is a DNA seqeunce: G G C A A C T A T C C C G A T T A G C G C Write down the…

A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. The structure of…

Q: B D A E 1. The RNA primer is denoted by letter 2. The leading strand is denoted by letter 3. The…

A: The DNA replication involves synthesis of new DNA from the old DNA by semiconservative mode. The DNA…

Q: if one strand of the DNA molecule has the sequence 5’ TACGA 3, The other strand would have the…

A: DNA or Deoxyribonucleic acid is the genetic material which passes from one generation to another.…

Q: a.Write out the complementary strand to the following sequence. Begin with the 5' of the end of the…

A: The Nucleotides polymers that are responsible for determining and regulating the genetic…

Q: 17. Complete the following Central Dogma Grid Puzzles: First determine which DNA strand is the…

A: A "nucleic acid" is a linear polymer of nucleotides that is a component of the cell's information…

Q: a. what is the nucleotide sequence of the DNA chain synthesized from the primer. label the 5' to 3'…

A:

Q: 4b) What is the functional difference between heterochromatin and euchromatin? In other words, what…

A: Euchromatin is a type of chromatin that is loosely packed. It is a chromosomal region with a high…

Q: 13. A particular template strand of DNA has the sequence listed below: 3' G C A G A T A A T C 5' а.…

A: Template and coding strand are two different strands of DNA, in which template strand act as base…

Q: b. Now do this AGAIN assuming that the DNA and RNA templates are read right to left. DNA strand DNA…

A: The mRNA is produced from the DNA template by the transcription process and then mRNA is used for…

Q: None

A: Detailed explanation: 1. Digital Image of Gel and LabelingTo obtain and label a digital image of…

Q: 5’-GATCAGCTGACTGGATCCGTCCTCAACGTCAGGATCCAGCTTCAAG-3’ 1. How many cuts do you expect this enzyme to…

A: Some enzymes are called endonucleases cleave the phosphodiester bonds that exist in the DNA. Some…

Q: e) and explain

A: The association of 5mC with alternative splicing also challenges the general repressive role of 5mC.…

Q: 2. Dr. Kim at Ewha Research Center performed shotgun Sanger sequencing on ar unknown DNA sample, and…

A: This is sequence alignment which can be done by putting each fragment in such a way that it may…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.