### Transcription of DNA Coding and Template Strands to mRNA and Polypeptides**Instructions for Interpreting the Sequence Grid:**1. **Sequence Types and Orientation:** - Identify sequence types by filling in “template” and “coding” for the DNA strands based on provided nucleotides. Use mRNA clues for identification. - Note the polarity for each sequence in the second and last columns (5’, 3’, N, or C).2. **Transcription and Translation Alignment:** - Fill in nucleotides assuming the template sequences are read from **LEFT to RIGHT**.3. **Polypeptide Determination Using mRNA Codon Table:** - Use the mRNA sequence to determine the polypeptide sequence. The sequence starts in the middle of a coding sequence, so a start sequence is not needed.**Grid Details:**When the table is read from **LEFT to RIGHT**:```- DNA Strand 1: (Place "template" or "coding" appropriately) - DNA Strand 2: (Place "template" or "coding" appropriately)| DNA Strand | | | T | | G | C | A ||--------------|---|---|---|---|---|---|---|| mRNA codon | | | A | C | G | U | || tRNA anticodon| | | | | | U | G | G || polypeptide | | | | | | GLY | |```4. **Repetition with Orientation Reversal:** - Repeat the steps (1a-1d) with template sequences read from **RIGHT to LEFT**.**Grid Details (Right to Left):**When the table is read from **RIGHT to LEFT**:```- DNA Strand 1: (Place "template" or "coding" appropriately)- DNA Strand 2: (Place "template" or "coding" appropriately)| DNA Strand | | | T | | G | C | A ||--------------|---|---|---|---|---|---|---|| mRNA codon | | | A | C | G | U | || tRNA anticodon| | | | | | U | G |

Name: ### Transcription of DNA Coding and Template Strands to mRNA and Poly
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: ### Transcription of DNA Coding and Template Strands to mRNA and Polypeptides**Instructions for Interpreting the Sequence Grid:**1. **Sequence Types and Orientation:** - Identify sequence types by filling in “template” and “coding” for the DNA str

DNA is composed of nitrogenous bases (A,T,G and C), deoxyribose sugar and a phosphate molecule. DNA…

Science

Biology

a. The column to the far left identifies the sequence type. Based on the nucleotides given, fill in the words "template" and "coding" (non-template) for the two DNA strands as soon as you figure out which is which. (hint: look at mRNA) b. In the second and last columns, write the polarity of the ends of each sequence (5', 3', N or C). c. The remaining columns represent transcriptional and translational alignments. Fill in all nucleotides, assuming that the template sequences in the table are read from LEFT to RIGHT d. Using the mRNA codon table provided on the next page, determine the polypeptide sequence. This sequence is from the middle of a coding sequence, therefore you do not need a start sequence. T DNA DNA mRNA codon tRNA anticodon polypeptide A C GLY G U G G G C A U

a. The column to the far left identifies the sequence type. Based on the nucleotides given, fill in the words "template" and "coding" (non-template) for the two DNA strands as soon as you figure out which is which. (hint: look at mRNA) b. In the second and last columns, write the polarity of the ends of each sequence (5', 3', N or C). c. The remaining columns represent transcriptional and translational alignments. Fill in all nucleotides, assuming that the template sequences in the table are read from LEFT to RIGHT d. Using the mRNA codon table provided on the next page, determine the polypeptide sequence. This sequence is from the middle of a coding sequence, therefore you do not need a start sequence. T DNA DNA mRNA codon tRNA anticodon polypeptide A C GLY G U G G G C A U

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Similar questions

Original sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3
Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs (what letters changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions (with spaces), and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - CCTCGTTATGTG - 5' Mutated DNA Sequence: 3' - CCTCGTTATTTG - 5'
Complete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and mutated FGFR3 gene (BOTTOM). Remember, when filling in mRNA, use capital letters only. When filling in amino acids, use three letters, with the first letter capitalized. If you do not use this format, your answer may be marked wrong. DNA CCG TTC GGG GAA ССС MRNA Amino Acid DNA CCG TTC GGG GAA TCC MRNA Amino Acid
Neeed help:. . Fill out the following table, using wobble whenever possible
BamHI cut sequence: G//GATCC and each sequence is 250 nucleotides long. How many DNA segments would be created by cutting the normal gene with BamHI?
a) Complete the table below. Assume that reading is from left to right and that the columns represent transcriptional and translational alignments. Label the 5’ and 3’ ends of DNA and RNA and carboxy and amino acid ends of protein. (You may fill in this chart by hand writing- no typing necessary here.) 2. b) Is the top or bottom DNA strand the template strand?
As you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________
Below is the DNA sequence of a gene, what is the protein sequence? 5'-GGTAAGCTAGCTATGACTACCCTGACATAGATATCGACTAGCTG-3' Insert the amino acid sequence using the single letter designation for the amino acid (ex: use ACG instead of AlaCysGly). Include only the letters in the correct order as they would be translated using no commas, no spaces and no dashes.
Genetics Attached is a segment of DNA (doublestranded). Answer the following questions about the segment of DNA: How many open reading frames (ORF) are in this sequence? How many amino acids are encoded in all open reading frames in this segment/sequence? Which strand is the template strand for the longest open reading frame?
Please fill out the following table. Circle sense or template strands. Indicate 5’, 3’, amino and carboxy ends. Use wobble whenever possible
Using the following coding DNA sequence:TAC GCA CCT TTA GAT CAT AAC TTT GGA ACT1. Write the complementary DNA sequence that would form the double helix: 2. Write the sequence of the mRNA transcript that would be produced from transcription (use the original sequence, not the complement you just wrote): 3. Now, using the mRNA transcript and the table, write the amino acid strand produced from translation:
State if the DNA is written 5' to 3' or 3' to 5' Transcribe the sequence. Include the 5' and 3' Translate the sequence (codon chart included) +1 TAGTCCAAAGGTTTACGTAAATGGGATGTCGAAATTGACTAGATCA