1. For each of the sequences, place an X in the box to indicate the process most immediately affected by deleting the gene sequence. Only choose one process for each sequence. Process most immediately affected RNA processing translation Gene Sequence deleted replication transcription Shine Dalgarno AUG codon oric Pribnow box DnaA box -10 sequence 3' splice site Ter site TATA sequence UGA codon primase guanlyltransferase enhancer mediator

Q: Section B: True / False (5 marks) 1. Primase has a DNA dependent RNA polymerase activity. 2.…

A: True or false statement Primase is a kind of RNA polymerase that is involved in the replication of…

Q: What would be the 5 first nucleotides that form the mRNA?

A: Transcription is an important step in the gene expression in eukaryotes and Prokaryotes. It involves…

Q: The sequence below represents the template strand of DNA of the first two exons (out of 5) of a…

A: DNA is the hereditary material present in most of the eukaryotic organisms.The full form of DNA is…

Q: 16. Consider the following original coding sequence of a gene that codes for a short 3-amino acid…

A: The genetic code is a set of rules used by living cells to translate information encoded in genetic…

Q: Match the features to the labeled parts (Some may be used mutliple times, and not all labeled names…

A: Answer. A -  N terminus- A polypeptide synthesis proceeds from N- terminus to C-terminus and…

Q: Addition of a 5'7-methyl guanosine cap to the primary RNA transcript during nuclear processing *…

A: In eukaryotes, the mRNA when transcribed from DNA comes as a pre-mRNA that undergoes the following…

Q: 2. Given a DNA template molecule of 5'- ATGGCTCCTACCTACTAGTTAACATATGG-3', generate the mRNA sequence…

A: We are given a sequence of DNA in 5'-3' direction.  We have to generate the mRNA sequence and then a…

Q: 4. The template strand from the previous question is mutated to the DNA sequence shown below: 3' GTC…

A: transcription is the process by which messenger rna is made from dna .

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: 8. For the double strand DNA molecule below, assume the 3' DNA strand acts as the template for…

A: The process in which the DNA is converted into mRNA is called transcription and in which mRNA is…

Q: 7. Complete the following diagram which describes a small eukaryotic open reading frame, by filling…

A: Template Strand:The template strand is indeed the DNA strand that serves as a template during…

Q: b. You have found two mutant alleles of Gene A that have insertion of the three base pairs (as shown…

A: DNA is the deoxyribonucleic acid. It is a double-stranded molecule, which consists of two strands:…

Q: The sigma subunit of bacterial RNA polymerase ________________________.   is required for the…

A: RNA polymerase "core" from E. coli consists of five subunits: two alpha (α) subunits of 36 kDa, a…

Q: The template strand of a gene has the sequence 5'- CTACCGCGCGGTGCTAGGGGCCAT-3' What is the third…

A:

Q: Consider which of the five mutations is most likely to cause Duchenne muscular dystrophy in this…

A: Duchenne muscular dystrophy is a disease charecterised by muscular weakness due to lack of a protein…

Q: The diagram shows a double-stranded section of DNA. Identify the site of transcription initiation on…

A: A RNA  is produced by the process of transcription. Unit of transcription is called transcription.…

Q: In bacteria, since the mRNA does not require any processing to become active, and also since…

A: The cells are the primary unit of life. An organism may be unicellular or multicellular. The…

Q: Which of the following are similar characteristics shared between DNA replication and transcription?…

A: Introduction :- Replication is the process of synthesis of the DNA molecule . It occurs in S (…

Q: In prokaryotic RNA synthesis the rate of incorporation of nucleotides is constant throughout the…

A: In prokaryotes, RNA synthesis is carried out the enzyme RNA Polymerase. RNA Polymerase read the DNA…

Q: What happens when EF-Tu is mutated? Choose from the options below. Be involved in transcription…

A: Elongation Factor Thermo Unstable (EF-Tu) is one of the most prevalent proteins in bacteria, making…

Q: 5. What is the correct reading frame for the following mRNA? MRNA 5' GGCACUUAUGCGAUGCCUUGAGUGACCAU…

A: mRNA is made from DNA by the process of Transcription.

Q: Choose from the following: 5'cap, exon, a site, promoter, p site, intron, AAUAAA, start condon 1.…

A: Transcription is the process by which genetic information encoded in DNA is used to synthesize a…

Q: Identify the parts of a mature mRNA Which of the following is found in the mature mRNA but not in…

A: mRNA It refers to the messenger ribonucleic acid which is single stranded RNA that is read by the…

Q: Upon going through the complete process of gene expression, which amino acid would be most likely to…

A:

Q: DNA RNA Triplet codon Transcription Translation TATA box Start codon RNA processing 5' cap poly A…

A: Introduction  DNA is a double-stranded molecule with a lengthy sequence of nucleotides. A…

Q: 3)Which of the following are involved in translation? Choose all that apply ribosome tRNA amino…

A: Answer-  Involved in translation are  :- ribosome tRNA  mRNA rRNA amino acids

Q: Identify the parts of a matur mich of the following is found in nucleotides 5 can

A: mRNA or messenger RNA are polynucleotide molecules having backbone of ribose sugar and phosphate.…

Q: 8. For the double strand DNA molecule below, assume the 3' DNA strand acts as the template for…

A: The process in which the DNA is converted into mRNA is called transcription and in which mRNA is…

Q: The arrow in the diagram below indicates the direction of transcription. A BTTT…

A: Q. Ans:- The given image shows the process of transcription. Transcription:- Transcription is a…

Q: 25.  A portion of an mRNA attached to a ribosome reads:   5′ GACAUGAACAGC 3′ If a tRNA with a…

A: The translation is a process of Protein synthesis where a copy of mRNA is used as a template strand.…

Q: 16. Consider the following original coding sequence of a gene that codes for a short 3-amino acid…

A: DNA is a self replicating molecule. The process by which mRNA is produced from DNA is called…

Q: Name each of the processes pictured: 5'

A: protein synthesis ELONGATION PHASE OR PROCESS SPLICING TERMINATION PHASE OR PROCESS

Q: Label if each of the fonowing Sequences are present in DNA, pre-RNA andlor MRNA Of eukanyotes :…

A: All the information is present in the DNA that will be required for the synthesis of proteins. In…

Q: If this was an eukaryote, what would you find in the leftmost cytosine? 5' Poly A tail 3' Poly A…

A: IntroductionIn eukaryotic mRNA, there are two important structures that are added to the ends of the…

Q: 1. Identify the name of the correct amino acid that corresponds to the correct tRNA codon and mRNA…

A: The process of the formation of the mRNA from the DNA is called as transcription. The process of the…

Q: E channel Charged tRNA Anticodon for START Initiating factors Release factors III III E III = exit…

A: The transition of mRNA into protein is known as translation, and it is a fundamental process in…

Q: II. Use the eukaryotic gene DNA sequence below to answer the following questions: 1 11 21 31…

A: Codons are sequences of the three nucleotides (adenine, cytosine, guanine, and uracil) which are…

Q: Addition of 3’-CCA to tRNA is an example of which of the following? Post -replicational modification…

A: The question is asking to identify the type of modification that is represented by the addition of…