Consider which of the five mutations is most likely to cause Duchenne muscular dystrophy in this family. Would this mutation affect the process of replication? Would this mutation affect the process of transcription? Would this mutation affect the process of translation? Explain your reasoning.

Q: Will an insertion or a deletion of three nucleotides result in a frameshift mutation? Explain why or…

A: The frameshift mutation is the mutation by which the amino acid frame is changed. It is usually…

Q: Choose the answer that has these events of the elongation phase of translation in the proper…

A: Translation refers to the production of proteins using mRNA and ribosomal machinery. The ribosome…

Q: The chemical bisulfite transforms cytosine (C) to uracil (U) (U). In DMSO, bisulfite is dissolved.…

A: Dimethyl sulfoxide is an organosulfur compound with the formula (CH₃)₂SO. The chemical bisulfite…

Q: The gene ABCD is 1500 bases long.  Answer the following questions:   What would be the likely…

A: Introduction DNA is an organic molecule that includes genetic information as well as instructions…

Q: A) Describe each step of the DNA REPLICATION in EUKARYOTIC organisms B) Describe each step of the…

A: Transcription = Re-writing DNA into RNADNA is "transcribed" or re-written into RNA in a very…

Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…

A: Gene expression is a process by which the genes are turned on to form RNA and proteins. This is seen…

Q: You are observing the translation process in a eukaryotic cell that has been exposed to an unknown…

A: Translation is the process by which the genetic information encoded in mRNA is used to synthesize…

Q: In EUKARYOTIC translation, how does initiation of translation occur? a) What components of the…

A: The process of decoding the genetic information carried by mRNA molecules in order to synthesize…

Q: A mutation is found in a tRNA-encoding gene. The wild type (non-mutant) allele (version) produces a…

A: tRNA (transfer RNA) is a type of RNA that helps decode the genetic information in mRNA to build…

Q: The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1)…

A: At first you have to know about coding and non-coding strand. A coding atrand is a DNA strand that…

Q: A single template strand of a DNA molecule is represented by  3’atgtaccatgcgcaaatttaaaggccc5’. a)…

A: The transcription is the process in which the mRNA copied information from DNA for protein…

Q: The sequence of the start of the c-Myc gene is as follows (first picture): Use this information to…

A: Transcription takes place on the strand called as template strand it has a polarity of 3' - 5', thus…

Q: You’re going for a bike ride, and as your muscles work harder, your body needs to produce more of…

A: Genes are specific sequences in DNA that code for specific protien required for cell functioning.…

Q: Would a gain of function mutaion that occurs in the first exon of a gene with twelve exons more…

A: Gain-of-function type of mutation is a mutation in which the altered gene product possesses a new…

Q: The -10 & -35 sequences specify __________ . Question 2 options: A) which strand is the template…

A: Introduction: The synthesis of the RNA molecule (mRNA) from the DNA is known as transcription.

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: Which of the following recognizes the mRNA codon 5' - U A A - 3'?

A: Firstly, information is transferred from the DNA to mRNA by the process known as transcription. Then…

Q: Describe, in detail, causes for mutations that occur during replication. For each, use detail to…

A: The mutation is basically an alternation of codons which can be due to various factors. We can have…

Q: You are studying a colony of cells and determine that some of these cells have a mutated DNA…

A: Deoxyribonucleic acid (DNA) is a hereditary molecule that passes genetic information from one…

Q: Cytosine

A: Introduction :- A mutation occurs when a DNA gene is damaged or changed in such a way as to alter…

Q: Given the following DNA sequence from the template strand of a given gene:…

A: Codon is a  sequence of three nucleotides which together form a unit of genetic code in a DNA or RNA…

Q: man rhodopsin gene is 2675 nucleotides long from transcription start site to transcription stop…

A: The rho factor provides directions for creating a macromolecule referred to as rhodopsin. This…

Q: Original DNA sequence: mRNA transcript: amino acids: Mutated DNA sequence #3: mRNA transcript:…

A: This practice sheet is about transcription and translation. Transcription is a process in which mRNA…

Q: The overall structures of RNA polymerase and DNA polymerase are very different, yet their active…

A: DNA polymerase help in DNA replication whereas RNA polymerase help in transcriptions. Both have…

Q: During the process of transcription, the polymerase must handle several distinct polynucleotide…

A: Introduction :- Because its sequence will match that of the new RNA molecule, the nontemplate strand…