Consider which of the five mutations is most likely to cause Duchenne muscular dystrophy in this family. Would this mutation affect the process of replication? Would this mutation affect the process of transcription? Would this mutation affect the process of translation? Explain your reasoning.

Q: Here is a eukaryotic gene. The numbers given are base pairs of exon and intron. How long in bases…

A: In eukaryotic organisms, the gene contains introns as well as exons.  Eukaryotic genomes are much…

Q: Choose the answer that has these events of the elongation phase of translation in the proper…

A: Translation refers to the production of proteins using mRNA and ribosomal machinery. The ribosome…

Q: The chemical bisulfite transforms cytosine (C) to uracil (U) (U). In DMSO, bisulfite is dissolved.…

A: Dimethyl sulfoxide is an organosulfur compound with the formula (CH₃)₂SO. The chemical bisulfite…

Q: 2a) Suppose you have a gene in which a single base substitution has created the nonsense mutation…

A: DNA(deoxyribonucleic acid) is the genetic material in all the organisms except few viruses. The…

Q: You may wish to consult the genetic code above to answer the following question. A mutation has…

A: Missense mutation is the mutation in which single amino acid change occurs. The other amino acid in…

Q: You may wish to consult the genetic code above to answer the following question. A mutation has…

A: Mutation is the sudden change in the base pair of sequence resulting in altered phenotype. The…

Q: In EUKARYOTIC translation, how does initiation of translation occur? a) What components of the…

A: The process of decoding the genetic information carried by mRNA molecules in order to synthesize…

Q: The following eukaryotic DNA sequence is a made up gene. It is a mutated variant from the one that…

A: The genetic framework is a collection of instructions used by living cells to decipher data encoded…

Q: During high stress environments, it has been found that some bacteria activate a genetic mechanism…

A: The given enzymes are used in the replication process. It is a process wherein the genetic material,…

Q: The sequence of the start of the c-Myc gene is as follows (first picture): Use this information to…

A: Transcription takes place on the strand called as template strand it has a polarity of 3' - 5', thus…

Q: You’re going for a bike ride, and as your muscles work harder, your body needs to produce more of…

A: Genes are specific sequences in DNA that code for specific protien required for cell functioning.…

Q: Complete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and…

A: FGF3 gene is responsible for producing a protein called fibroblast growth factor 3 which is a part…

Q: The -10 & -35 sequences specify __________ . Question 2 options: A) which strand is the template…

A: Introduction: The synthesis of the RNA molecule (mRNA) from the DNA is known as transcription.

Q: Will the exon missense mutations be more likely to be transitions or transversions? Define both in…

A: Introduction  A mutation is a change that occurs in the DNA sequence of an organism. DNA…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: (a) Which of the following statements is TRUE?     DNA polymerase moves in a 5 to 3 direction in…

A: The biological process by which the information encoded inside a DNA (deoxyribonucleic acid)…

Q: Researchers are studying the mechanism of the antibiotic chloramphenicol. They know that it prevents…

A: The protein is synthesized by the process of translation. It takes place in cytoplasm of cell.

Q: Which of the following recognizes the mRNA codon 5' - U A A - 3'?

A: Firstly, information is transferred from the DNA to mRNA by the process known as transcription. Then…

Q: Figure 2 illustrates a type of gene mutation.     a) State the type of gene mutation shown in…

A: Mutation  Mutation is the alteration in the original sequence of DNA. Mutation can be caused due to…

Q: You are studying a colony of cells and determine that some of these cells have a mutated DNA…

A: Deoxyribonucleic acid (DNA) is a hereditary molecule that passes genetic information from one…

Q: Codons 24 to 66 represent an intron.  At what point in the process of protein synthesis are introns…

A: Transcribing DNA to RNA is the initial step in a long process that finally synthesizes functional…

Q: Identify whether each of the following descriptions applies to typical prokaryotic genomes only,…

A: In these questions, we will learn about different things in cells, like their DNA (the instructions…

Q: Given the following DNA sequence from the template strand of a given gene:…

A: Codon is a  sequence of three nucleotides which together form a unit of genetic code in a DNA or RNA…

Q: man rhodopsin gene is 2675 nucleotides long from transcription start site to transcription stop…

A: The rho factor provides directions for creating a macromolecule referred to as rhodopsin. This…

Q: The overall structures of RNA polymerase and DNA polymerase are very different, yet their active…

A: DNA polymerase help in DNA replication whereas RNA polymerase help in transcriptions. Both have…

Q: 3'-TAC TGA GCA AGA TTA CAT ACT-5' Write down the mRNA sequence for the given DNA sense strand…

A: A mutation in both copies of the HBB gene results in sickle cell disease (SCD), a hereditary…

Q: During the process of transcription, the polymerase must handle several distinct polynucleotide…

A: Introduction :- Because its sequence will match that of the new RNA molecule, the nontemplate strand…

Q: Given the following sequence of a coding DNA strand: AGTTGCGCATGCCAGAGAGGTTCGAGTGCACATAACTTGAG The…

A: DNA is a double stranded molecule with coding strand and template strand. Template strand is the one…

Q: For each of the following sequences, place a check mark in the appropriate space to indicate the…

A: DNA replication is the process of generating two identical copies from the original DNA strand. The…

Q: This is a list of molecular changes that could happen during DNA replication, transcription, mRNA…

A: The mutation alters allele frequencies by constantly introducing new alleles, which can be…

Q: 5. a) Describe, using a diagram or point form notes, what is happening during transcription and…

A: Transcription is the process of copying genetic information from one strand of the DNA into RNA.…

Q: A mutation has occurred to a wild type mRNA sequence: Wild Type: 5’-AUG-UUG-CAA-GCG-3’ The new…

A: A mutation is a change in the nucleotide sequence of the DNA of an organism. Mutations can be caused…

Q: Given: eukaryotic cells can make different proteins, using only one gene. How can a eukaryotic cell…

A: Genetic material in eukaryotic cells is DNA present inside the nucleus. DNA is transcribed to form…

Q: In the table below, there are four versions of gene A, one of which is normal, and the other three…

A: Mutations are sudden heritable changes that change gene expression. These changes in gene expression…

Q: Huntington’s disease is an inherited neurological ailment with a variable age of onset. A protein…

A: Huntington's disease is a neurodegenerative disorder. The repetition of a CAG trinucleotide causes…