7. Complete the following diagram which describes a small eukaryotic open reading frame, by filling in polarities, nucleotides and amino acids as required: -Direction of transcription- G Template strand 3' T Non-template strand 5' mRNA codons tRNA anticodons - Amino-acids lys - C G - C 5' с _ G _ G_ A 3' — G

Q: What would be the 5 first nucleotides that form the mRNA?

A: Transcription is an important step in the gene expression in eukaryotes and Prokaryotes. It involves…

Q: 15. The following is a list of some mRNA codons representing various amino acids. Met-AUG, Pro -…

A: The genetic code is the set of rules by which information encoded within genetic material,…

Q: Identify the parts of a gene/transcription unit and identify the parts that are transcribed. The…

A: DNA is the nucleic acid that behaves as a carrier of genetic information in almost all biological…

Q: Molecule Sequence Hb A DNA 5’ GGC AGA CTT CTC CTC AGG AGT CAG GTG CAC 3’ Hb A mRNA   Hb A…

A: Specific DNA sequences encode hemoglobin, a critical molecule for oxygen delivery in red blood…

Q: 2' HO 5' OH-3' -OH-3 |3' M O A represents Group I introns and B represents spliceosome introns O A…

A: Here,the answer is A represents Group II introns and B represents Group I introns. Group I and Group…

Q: Which process is illustrated in the diagram? Pre-mRNA Exon 1 Lariat Exon 1 BEIN Intron Step 1 Step 2…

A: mRNA splicing is a process by which a newly made precursor messenger (m) RNA transcript is…

Q: Coding strand of DNA, complimentary to the template strand 5' 3' A T G C T T G CA CATT G a GA A G A…

A: A molecule made up of two chains of a polynucleotide that generate a double helix by coiling around…

Q: 1. For each of the sequences, place an X in the box to indicate the process most immediately…

A: Note: According to the guidelines, we are supposed to answer only one question. Please repost other…

Q: 4. The template strand from the previous question is mutated to the DNA sequence shown below: 3' GTC…

A: transcription is the process by which messenger rna is made from dna .

Q: Based on your know | (hir sequence.

A: In many eukaryotic (and other prokaryotic) genes, the original RNA extracted from a genetic DNA…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: In Figure 10-4, why is cDNA made only from mRNAand not also from tRNAs and ribosomal RNAs

A: Introduction  Central Dogma: it is the key mechanism by which DNA can be transcribed into mRNA by…

Q: The DNA sequence shown below is for a very short gene with no introns. What is the mRNA sequence for…

A: mRNA Accounts for about 5%of the total RNA in the cell . Most heterogeneous of the three types of…

Q: During translation, a peptide is PRODUCED , while the MRNA is READ N-->C, 3-->5' 5'-->3'; N-->C.…

A: ANSWER;- N'-- C; 5'--3';

Q: Examine the following sequence of DNA 3’-CTA – TAC – TTA – CGC – GTA – CAT – GCG – TGA – CCC - ACG –…

A: The central dogma is a metabolic process where the  DNA acts as genetic material and transcripted…

Q: If this was an Eukaryote, after this transcript undergoes processing and exits the nucleus what…

A: The question is asking about the structure of a mature mRNA transcript in a eukaryotic cell after it…

Q: Which process is illustrated in the diagram? Replication Transcription RNA processing Translation…

A: We are given an image of circular double stranded DNA with unwinding of two strands at one point.…

Q: The template strand of a gene has the sequence 5'- CTACCGCGCGGTGCTAGGGGCCAT-3' What is the third…

A:

Q: Which one of the following mutations to the coding region of a gene would change the codon reading…

A: A mutation is a change that occurs in the genetic material (DNA) of an organism. Mutations can occur…

Q: The diagram shows a double-stranded section of DNA. Identify the site of transcription initiation on…

A: A RNA  is produced by the process of transcription. Unit of transcription is called transcription.…

Q: In prokaryotic RNA synthesis the rate of incorporation of nucleotides is constant throughout the…

A: In prokaryotes, RNA synthesis is carried out the enzyme RNA Polymerase. RNA Polymerase read the DNA…

Q: None

A: The given DNA3' CACTACGGCGCTGCGTGACCGATCACAGTGCGT 5' 5' GTGATGCCGCGACGCACTGGCTAGTGTCACGCA 3'  In the…

Q: Which arrow in the diagram of transcription below is labeling the 'SENSE DNA strand? Note that the…

A: A DNA sequence is transcribed into an RNA molecule with the help of the enzyme RNA polymerase is…

Q: Classify the following functions or structures as being attributed to proteins, RNA, or RNA-protein…

A: A. Proteins -  Poly A polymerase Release factors (RF1 and RF2) Formation (catalysis) of peptide…

Q: Attached is a region of DNA containing a transcription unit. Match the boxes with the terms…

A: The DNA contained the genetic information that is transcribed into mRNA by the process of…

Q: If this was an Eukaryote, after this transcript under A (T) (C) C G G DE G g and exits the nucleus…

A: The correct answer is option D. 5; Cap

Q: What is the base sequence of a mRNA strand that is complementary to the DNA sequence 5'-ATCGGATTC-3'…

A: Transcription is the process by which an RNA molecule is synthesized from a DNA template. It is a…

Q: Identify the parts of a mature mRNA Which of the following is found in the mature mRNA but not in…

A: mRNA It refers to the messenger ribonucleic acid which is single stranded RNA that is read by the…

Q: Which arrow in the diagram of transcription below is labeling the 'SENSE DNA strand? Note that the…

A: In genomics, transcription is the process of creating an RNA copy of a gene's DNA sequence. This…

Q: 63 62 GI GS G4 GGU AUG GCC AUG CUC ACG GAG UAC CGG R (the strane CUC GAG AAG The original template…

A: the process shown in the picture above is is protein translation where protein is translated…

Q: 1 An Amino Acid Sequence Leu - Tyr - Gly-Gly - Val Which of the following changes to the mRNA that…

A: The amino acids in the given sequence are leucine, tyrosine, glycine, glycine, and valine.