If this was an Eukaryote, after this transcript undergoes processing and exits the nucleus what would you find at this extreme? A Previous A T Intron Exon UAA 5' Poly A tail 5' Cap 3' Poly A tail 3' Cap C GEG C G G G C C GG A AMT А C G T UAA А G G C T A G G A T C G G

If this was an Eukaryote, after this transcript undergoes processing and exits the nucleus what would you find at this extreme? A Previous A T Intron Exon UAA 5' Poly A tail 5' Cap 3' Poly A tail 3' Cap C GEG C G G G C C GG A AMT А C G T UAA А G G C T A G G A T C G G

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Related questions

Q: al mRNA: 5’- AUG GGC UCG ACC UUG -3’ Mutant mRNA 1: 5’- AUG GGC UAG ACC UUG -3’ Mutant mRNA 2: 5’-…

A: The physical and functional unit of heredity is the gene. They pass on knowledge from one generation…

Q: sgRNA GFP Exon 1 Exon 1 Intron 1 Exon 2 Exon 2 Intron 2 Exon 3 Intron 3 Exon 4

A: Messenger RNA (mRNA) is a cellular component that transports instructions from DNA in the nucleus to…

Q: ALTE

A: Exon is a genetic code region that contains the information needed to enter a protein code. In…

Q: please answer the question provided in the picture about the black allele gene asap please

A: INTRODUCTION Translation is the process of translating the sequence of a messenger RNA (mRNA)…

Q: 1. For each of the sequences, place an X in the box to indicate the process most immediately…

A: Note: According to the guidelines, we are supposed to answer only one question. Please repost other…

Q: If the template DNA is 3' A GCTAC5' then the mRNA sequence is

A: Ans- As mentioned the DNA template 3’ – A G C T A C – 5’ The mRNA sequence will be – a) 5’…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine, The possible codons can be CCG CGC GCC GGC GCG CGG

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: 8. For the double strand DNA molecule below, assume the 3' DNA strand acts as the template for…

A: The process in which the DNA is converted into mRNA is called transcription and in which mRNA is…

Q: With respect to an intron, which one of the following options would be a good way to identify the…

A: DNA of eukaryotic genes contain split structures where segments of coding sequences are separated by…

Q: A C mRNA (Met Gly F GGG AUGCCCACG UAG Which letter indicates the amino end of the growing…

A: A covalent link known as a peptide bond connects the carboxyl group (-COOH) of one amino acid to the…

Q: Which of the following eukaryotic MRNA transcripts would NOT be able to be translated? Select ALL…

A: Translation It is defined as the process of formation of proteins by the ribosomes present in the…

Q: In eukaryotes, the initial transcript, pre-mRNA, must be modified in three ways before it leaves the…

A: The premature mRNA (pre-mRNA) are produced from the DNA template strand within the nucleus of…

Q: Which process is illustrated in the diagram? Replication Transcription RNA processing Translation…

A: We are given an image of circular double stranded DNA with unwinding of two strands at one point.…

Q: Exonucleases can digest the poly A tail of eukaryotic mRNAs in the 3' to 5' direction which thereby…

A: Transcription is a process through which the template strand of DNA gets transcribed into mRNA. In…

Q: The template strand of a gene has the sequence 5'- CTACCGCGCGGTGCTAGGGGCCAT-3' What is the third…

Q: Using the table above and the mRNA transcript AUG-CUC-UAC-AAG-UAG, choose the false statement: XXX…

A: Nucleic acids are involved in various processes in the cell, their main role is the expression of…

Q: a. Which amino acid does this code for? [Select] dentify the effect of the following point mutations…

A: Introduction Mutation is a sudden heritable change in our DNA or genetic material. Mutation can…

Q: 3' A TAT --IIL 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 DNA C GU UGA UG G MRNA TRNA Amino…

Q: What is the total size of the mature i.e. fully processed mRNA in nucleotides?

A: Primary transcript of mRNA contains exons as well as introns. But After the process of splicing…

Q: 20 ORF for gene X e for gene X above has a hypomorphic mutation (which you name Mutation #1) that is…

A: Answer.) :-The given question presents an experimental scenario involving Gene X, which has a…

Q: Identify one mistake that was introduced in the following figure. True or false? The first few…

A: Since it is the method through which DNA is utilized as a template to produce RNA, transcription is…

Q: Choose from the following: 5'cap, exon, a site, promoter, p site, intron, AAUAAA, start condon 1.…

A: Transcription is the process by which genetic information encoded in DNA is used to synthesize a…

Q: The sequence of mRNA made using the DNA double helix shown below is (Select ] The sequence of…

A: Introduction Protein synthesis is a two step process. In the first step, a molecule of mRNA is…

Q: If this was an Eukaryote, after this transcript under A (T) (C) C G G DE G g and exits the nucleus…

A: The correct answer is option D. 5; Cap

Q: O5-CAGCAUUA-3'

Q: 63 62 GI GS G4 GGU AUG GCC AUG CUC ACG GAG UAC CGG R (the strane CUC GAG AAG The original template…

A: the process shown in the picture above is is protein translation where protein is translated…

Q: 1 An Amino Acid Sequence Leu - Tyr - Gly-Gly - Val Which of the following changes to the mRNA that…

A: The amino acids in the given sequence are leucine, tyrosine, glycine, glycine, and valine.

Q: у OH ON Replication. OH

A: Molecular biology is a branch of biology that focuses on the study of biological molecules and their…

Q: 8. For the double strand DNA molecule below, assume the 3' DNA strand acts as the template for…

A: The process in which the DNA is converted into mRNA is called transcription and in which mRNA is…

Q: 2ith the diagram provided please write the polypeptide. sequence obtained from the translation of…

A: INTRODUCTION Translation is the process of translating the sequence of a messenger RNA (mRNA)…

Q: What is the length in bp of the 5’ UTR, the mature processed mRNA and protein-coding region of the…

A: Transcription is the process by which a messenger RNA (mRNA) is produced from DNA.Translation is the…

Q: Here is a schematic map with a scale of a eukaryotic gene. How long is the processed mRNA transcript…

A: Gene is the sequence of nucleotide that encode a particular amino acid. It is found in DNA.

Q: Your labmate gives you a gene with the following sequence of the coding strand for the first 5 amino…

A: given DNA strand first form the complimentary starnd by changing A - T and G-C for the strand 3' to…

Q: 5'UTR Coding sequence 3' UTR Poly-A tail I C A F D

A: Transcription is a process of central dogma in which the RNA strand is synthesized from the parental…

Q: What is the purpose of the underlined sequence? 5’ CAGGGTAGGTACTATGCCTGGATGCCATGGGTAAGGACTAATAAAG…

A: In molecular biology, understanding the purpose of specific nucleotide sequences is crucial for…

Question

If this was an Eukaryote, after this transcript undergoes processing and exits the nucleus what would you find at this extreme?
A
Previous
A
T
Intron
Exon
UAA
5' Poly A tail
5' Cap
3' Poly A tail
3' Cap
C
GEG
C
G
G
G
C
C
GG
A
AMT
А
C
G
T
UAA
А
G
G
C
T
A
G
G
A
T
C
G
G

AI-Generated Solution

AI-generated content may present inaccurate or offensive content that does not represent bartleby’s views.

Unlock instant AI solutions

Tap the button
to generate a solution

Click the button to generate
a solution

SEE SOLUTION

Similar questions

In eukaryotes, why is the initial RNA transcript usually longer than the mature mRNA molecule? Group of answer choices Because a guanosine cap has to be removed Because exons have to be removed Because a poly-A tail has to be removed Because introns have to be removed Because the RNA primer has to be removed
Eukaryotes modify mRNA with an m7G cap: an N7-methylated guanosine linked via a 5′ to 5′ triphosphate linkage, and by methylation at the 2'-hydroxyl of the penultimate nucleoside. What cofactors involved in the capping reaction
Describe how a mutation can occur using the image shown
The diagram below shows an imaginary eukaryotic structural gene containing two exons. The exon nucleotides are numbered beginning at the transcription start site and a portion of the intron is not shown to save space: Help Center? transcription start site promoter U STACAGTATAAATGAATTAATTGACGTATGTCAATCGGTAAGT...TCAGGTACT U UUU} Phe UUG} Leu exon 1 3 ATGTCATATTTACTTAATTAACTGCATACAGTTAGCCATTCA...AGTCCATGAATGACTTATGTGCGGTTATTTACTGAT... Second letter C Predict the amino acid sequence of the polypeptide encoded by this structural gene. The genetic code is provided below.
Unanswered gene has three exons that are 140, 230, and 130 bp, respectively. Intron 1 is 125 bp and intron s 95 bp. How long is the properly spliced mature RNA transcript? 220 500 720 1500
TATA TATAAT ATG STOP codon(s) AGGAGG CCUCCU ACCATEG GACA NAMENNI KEHIAKET III 11 11 11 11 Universal START codon Anti-Shine-Dalgama sequence found on ribosome Shine-Dalgamo consensus sequence Prokaryotic motif for RNAP RNA transcription termination motif downstream of STOP codon where CPSF binds Kozak consensus sequence Eukaryotic motif upstream of TATA Eukaryotic motif for RNA pol TAA and TAG and TGA Prokaryotic motif upstream of TATAAT
Prokaryotic and eukaryotic RNAS differ in which of the following ways? FRNA molecules are only part of the prokaryotic ribosome Prokaryotic RNAS have non-coding sequences that are removed during processing O Eukaryotes have a pre-mRNA that requires splicing to create a functional transcript O Eukaryotes have simpler ribosomes, consisting of fewer FRNAS