Here is a schematic map with a scale of a eukaryotic gene. How long is the processed mRNA transcript produced from this gene? Termination Start codon Stop codon sequence -35 -10 Exon 1 Intron 1 Exon 2 Intron 2 Exon 3 4. 5. Genomic sequence (kb) (k = kilo = 1,000) 2200 bases O 3200 bases 2000 bases 4200 bases

Here is a schematic map with a scale of a eukaryotic gene. How long is the processed mRNA transcript produced from this gene? Termination Start codon Stop codon sequence -35 -10 Exon 1 Intron 1 Exon 2 Intron 2 Exon 3 4. 5. Genomic sequence (kb) (k = kilo = 1,000) 2200 bases O 3200 bases 2000 bases 4200 bases

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

Look at the MRNA strand below. There are at least a few bases before the "AUG" or the start codon. Why is it important that "AUG" or the start codon NOT be the first 3 nucleotides of the mRNA sequence? The structure of a typical human protein coding MRNA including the untranslated regions (UTRS) Cap 5' UTR Coding sequence (CDS) 3' UTR Poly-A tail Start Stop 5' 3' 1 5'-UTR or 5' untranslated region
Use the DNA sequence above, list all possible splicing products
1 You will start with Transcription translation Sequence I. You are allowed two attempts 1 point Assemble the mRNA Transcription translation Sequence I. 546465-33-33-4448538854-266666668885-34-483- If this was an eukaryote, what would you find in the leftmost cytosine? 5' Poly A tail 3' Poly A tail 5' Cap 3' Cap 2 3 $ 4 er dº 5 6 7 8 9 0 + 11 Ne
Figure 15.11 A scientist splices a eukaryotic promoter in front of a bacterial gene and inserts the gene in a bacterial chromosome. Would you expect the bacteria to transcribe the gene? Primary RNA transcript Exon 1 Intron Exon 2 Intron Exon 3 RNA processing 000 5' cap Spliced RNA Exon 1 Exon 2 Exon 3 AAAAAAA Poly-A tail Suntranslated 3' untranslated region region Figure 15.11 Eukaryotic mRNA contains introns that must be spliced out. A 5' cap and 3 poly-A tail are also added.
Translate the protein that is expressed from this template DNA sequence. Transcription is going left to right, the intron is underlined. Codon table is provided. 3' ATCATGACCTACAGGCAGATGATTATAGACCCTGACATTTATTTGGCG 5'
Here is a schematic map with a scale of a eukaryotic gene. How long is the primary mRNA transcript produced from this gene? Termination Start codon Stop codon sequence -35 -10 Exon 1 Intron 1 Exon 2 Intron 2 Exon 3 3 4 Genomic sequence (kb) (k = kilo = 1,000) %3D 5000 bases 4200 bases 3200 bases 4800 bases
Using the codon charts in your text (section 6.1), fill in the chart below. [ /8] Original DNA sequence TAC GGA CAC GTT CGC AAC mRNA sequence tRNA anticodons Amino acid sequence Mutated DNA sequence TAC GGA CAC ATT CGC AAC mRNA sequence tRNA anticodons Amino acid sequence Type of mutation (highlight all that apply) Frameshift Nonsense Missense Silent Insertion Deletion Substitution
PLEASE HELPP
Give correct typing answer with explanation and conclusion You found a mutation in a gene that causes a reading frame shift early in its mRNA. This introduces an early stop codon that results in a complete lack of functional protein. Which of the following is the most likely cause of this mutation? A single base deletion in an exon of the gene A 6 base deletion in an intron the gene A 3 base insertion in an exon of the gene A 4 base insertion in an intron of the gene
Shown below are different regions of an eukaryotic gene. Which of the above regions of a gene will be transcribed? Or which regions will be part of the new RNA molecule that is synthesized during transcription? Select all that apply. Promoter Intron Exon Transcription stop sile Transcription start site 5- 31 ATG 75 TAC TAA ATT 3' 5' 50 100 300 200 228 50 3' 5' Start Splice donor codon Splice аcсeptor Splice acceptor Splice donor Stop codon Exons Ribosomal binding site Promoter Introns
Figure 2 is a schematic drawing of ABC gene, which encodes ABC protein. Transeriptional terminator Promoter Intron 1 Intron 2 1 100 s100 base pairs 1100 2100 3100 4100 Positions 200-203 = Start codon Positions 4800-4802 = Stop codon Figure 2. (i) The transcript first produced by ABC gene would be approximately how many nucleotides long?
Nuclear (N) and cytoplasmic (C) mRNA samples of a gene with 2 exons and one intron run on an agarose gel along with a size marker, are shown in the gel figure below. Ntds = nucleotides 3. What is the length of the primary mRNA? HINT: Check question 3c RNA sample: N a. C ntds 1900- b. What is the length of the processed MRNA? 1250 1000 800- 650 с. If the 1250 nucleotide and 650 nucleotide fragments are spliced mRNA intermediates as indicated in the splicing diagram below, what is the size in nucleotides of Exon 1 & Exon 2. Size 1 Markers Exon Intran Exon pre-MRNA AG GU (1) (2) I spliced MRNA 2.