TATA TATAAT ATG STOP codon(s) AGGAGG CCUCCU ACCATGG CAAT GACA AAUAAA M = H Universal START codon SE Anti-Shine-Dalgama sequence found on ribosome Shine-Dalgarno consensus sequence Prokaryotic motif for RNAP RNA transcription termination motif downstream of STOP codon where CPSF binds Kozak consensus sequence Eukaryotic motif upstream of TATA Eukaryotic motif for RNA pol HE TAA and TAG and TGA Prokaryotic motif upstream of TATAAT

Q: The following sequence represents the dsDNA code for a short peptide 5' -CTT TCC CAT CAC CGC ATG…

A: 3= No , it is not possible for codon to code for another amino acid . 4= UAA is a stop codon , if…

Q: A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:…

A: The Central dogma defines how DNA codes for proteins, which occur in three stages: replication,…

Q: Given the following genomic sequence which contains 2 exons and CDNA sequence predict the amino acid…

A: The introns are the non-coding parts of the premature mRNA that must be removed by…

Q: Arrange the following components of translation in the approximate order in which they would appear…

A: In prokaryotes, the protein synthesis takes place in the cytoplasm. It comprises two steps…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: The "factory" itself, made of two [Choose] subunits [Choose] FRNA The site from which the growing…

A: Hello. Since your question has multiple sub-parts, we will solve first three sub-parts for you. If…

Q: Use the genetic code below to determine the third amino acid in the protein translated from the…

A: Introduction Central Dogma: it is the key mechanism by which DNA can be transcribed into mRNA by the…

Q: The DNA in the coding strand below contains a short imaginary sequence for a short protein in…

A: DNA sequence: 5'-ATGTACCTCGACGATCAAGGCAA-3'1. m RNA sequence:Due to complementary base pairing rules…

Q: Chaperones AUG Zwitterion Tarm Aminoacyl-tRNA synthetase III III E - A compound with no electrical…

A: Chaperones are proteins that aid in the folding, assembly, and stabilisation of other proteins in…

Q: Use this mRNA coding sequence as your starting point. This sequence begins with a start codon and…

A: The Central Dogma theory states that DNA makes RNA and RNA makes protein. DNA undergoes Replication…

Q: eseg pL oseg sy non UCC UAU sko C. UAC UGA dos UGG UUA UCA UAA dois dois CGU ne UAG UCG dil CAU CUC…

A: Genetic code The combination of three nucleotides called codon . Each codon codes for an amino acid…

Q: First letter U C G U UUU Phenyl- UUC alanine Leucine UUA UUG CUU CUC CUA CUG AUU AUC Isoleucine AUA…

A: The central dogma is a fundamental principle in molecular biology that involves the transfer of…

Q: How many open reading frames are present in the following mRNA sequence? You may find the codon…

A: An open reading frame in molecular genetics describes the part of your reading frame that has the…

Q: a. Which amino acid does this code for? [Select] dentify the effect of the following point mutations…

A: Introduction Mutation is a sudden heritable change in our DNA or genetic material. Mutation can…

Q: The following segment of DNA in a hypothetical model organism encodes a polypeptide containing SEVEN…

A: Francis Crick proposed central dogma. The RNA is formed from DNA with the help of enzyme RNA…

Q: Noncoding Strand -> 5’ - G   C     C     A   G     G   T       C     A     G   G     T -   3’…

A: The terms used in the question represents the molecules involved in gene expression. A gene is a…

Q: This one is "charged" with an aminoacid. The specific sequence in the bottom is called the…

A: 5'-UCGGAAUGUGGUGGCAUACAGGCUUACAGAACUAAGUCUGAGAAU-3'As following the rules in genetic code the mRNA…

Q: Is this diagram of tRNA technically incorrect? Shouldn't it be 3' on the left and 5' on the right…

A: The tRNA or the transfer acyl Ribonucleic Acid serves as an adapter molecule during the process of…

Q: 5' cap amino acid aminoacyl tRNA synthetase anticodon codon EF-Tu-GTP EF-Ts eukaryote Kozak…

A: Three process combined together to form a central dogma that is replication where copy of genetic…

Q: List all single base substitutions that would change a codon for Leu to a nonsense codon. For each,…

A: Mutation: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to…

Q: DNA RNA Triplet codon Transcription Translation TATA box Start codon RNA processing 5' cap poly A…

A: Introduction  DNA is a double-stranded molecule with a lengthy sequence of nucleotides. A…

Q: 3’-TCTTCGTGAGATGATATAAGAGTTATCCAGGTACCGGTAAACTGG-5’…

A: The process of copying the information in a strand of DNA to produce an mRNA is called…

Q: Give the single letter translation for the protein encoded by this mRNA. Start with the start codon.…

A: DNA is the genetic material of the organisms which by the process of transcription forms mRNA. This…

Q: Below is the sequence of an mRNA that has just been transcribed. Please translate this sequence as…

A: Let's rearrange the mRNA in the codes of three.  ACG UCC AAU GGC AGU GAU UUG AAU CCA ACG codes for…

Q: Do not use Ai

A: source: Internet (to make understand the concept)

Q: 1. What is the first codon in the mRNA strand? 2. The second codon in the DNA double helix is TAT…

A: The DNA (deoxyribonucleic acid) that forms the genetic material of an individual contains…

Q: None

A: Step 1: Understanding the Anticodon and Codon RelationshipAnticodon: The anticodon is a sequence of…

Q: What is the purpose of the underlined sequence?   5’ CAGGGTAGGTACTATGCCTGGATGCCATGGGTAAGGACTAATAAAG…

A: In molecular biology, understanding the purpose of specific nucleotide sequences is crucial for…

Q: Second letter A G UUU Phenyl- UUC alanine UAU UAC UGU UGC Oysteine UCU Tyrosine UCC Serine UUA UUG…

A: The genetic codon present in the mRNA will be translated during the translation process by ribosome…

Q: An mRNA transcript is listed below and contains both start and termination codons. Assume that the…

A: mRNA(messenger RNA) is a type of RNA(ribonucleic acid) that carries complementary sequence…

Q: An anticodon of tRNA has the sequence GCA. What amino acid does this tRNA carry? HINT: you use mRNA…

A: Codons are in the form of triplets , for example AUG that codes for methionine ( amino acid). Codons…

Q: Suppose that a protein has the amino acid sequence…

A: Researchers need to take the degeneracy of the genome's code into account to calculate the amount of…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: The amino acids are coded by the group of three bases called base triplets and codons.

Q: The DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are…

A: A genetic code is a table consisting of 64 codons each of which code for specific amino acids. These…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.