Arrange the following components of translation in the approximate order in which they would appear or be used in prokaryotic protein synthesis: 70S initiation complex 30S initiation complex release factor 1 elongation factor G initiation factor 3 elongation factor Tu fMet-tRNAi fMet

Q: sgRNA GFP Exon 1 Exon 1 Intron 1 Exon 2 Exon 2 Intron 2 Exon 3 Intron 3 Exon 4

A: Messenger RNA (mRNA) is a cellular component that transports instructions from DNA in the nucleus to…

Q: Consider the Rho-dependent terminator sequence 5’CCCAGCCCGCCUAAUGAGCGGCCUUUUUUUU-3’. What affect…

A: The mutation is the change in the nucleotide sequence of the DNA. The point mutation is the mutation…

Q: Which of the following statements regarding "start" and "stop" signals apply to both transcription…

A: Introduction  The process of synthesising RNA from a DNA template, known as transcription, converts…

Q: D D Intron +1 E E A В В C GGGCGG GCCCAATCT TATAAA Intron -5000 -100 -25 1. What region functions…

A: The transcription is the process of conversion DNA to RNA . DNA stands for dioxy ribonucleic acid…

Q: Describe the role Ef-G-GTP has in elongation during translation.

A: The process of translating an mRNA strand into an amino acid sequence at the time of protein…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: Choose the answer that has these events of the elongation phase of translation in the proper…

A: Translation refers to the production of proteins using mRNA and ribosomal machinery. The ribosome…

Q: The chemical bisulfite transforms cytosine (C) to uracil (U) (U). In DMSO, bisulfite is dissolved.…

A: Dimethyl sulfoxide is an organosulfur compound with the formula (CH₃)₂SO. The chemical bisulfite…

Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…

A: Gene expression is a process by which the genes are turned on to form RNA and proteins. This is seen…

Q: Indicate which of the following items are associated with transcription or translation.  This could…

A:

Q: In eukaryotes, the initial transcript, pre-mRNA, must be modified in three ways before it leaves the…

A: The premature mRNA (pre-mRNA) are produced from the DNA template strand within the nucleus of…

Q: You are observing the translation process in a eukaryotic cell that has been exposed to an unknown…

A: Translation is the process by which the genetic information encoded in mRNA is used to synthesize…

Q: A synthetic mRNA added to a cell-free protein-synthesizing system produces a peptide with the…

A: Translation is the process of formation of protein using the information encoded in the mRNA. mRNA…

Q: Assume that this DNA molecule is from a bacterial cell. Draw the approximate locations of the…

A: Transcription is the process of copying genetic information from DNA (Deoxyribonucleic acid) into…

Q: EIF stands for eukaryotic initiation factors and they are part of the pre-initiation complex needed…

A: Protein synthesis is a vital process for cells to create proteins which are the building blocks for…

Q: Use the numbers below to indicate the correct order of events (from left to right) during the…

A: Hi, Thanks For Your Question.  Answer : Correct Sequence Is 3 4 2 1 5.

Q: The following segment of DNA in a hypothetical model organism encodes a polypeptide containing SEVEN…

A: Francis Crick proposed central dogma. The RNA is formed from DNA with the help of enzyme RNA…

Q: All of the following are needed for capping of eukaryotic mRNA, EXCEPT   Question 27 options:…

A: Eukaryotic mRNA is a single-stranded ribonucleic acid. This is associated with the protein…

Q: TRUE FALSE EF-Ts factor regenerates EF-Tu/GDP from EF-Tu/GTP for the next round of elongation cycle…

A: There are many biomolecules present in an organism and each biomolecule has a specific role.…

Q: For this double stranded DNA: 3’-AGGTCCAGTCTTCGGCGGATGATCGGGCCAACCCCCGTAACTGGTCACCGGAATGCC-5’…

A: 4 codes are used by the DNA that areAdenine (A), Thymine (T),  Guanine (G), Cytosine (C)RNA also…

Q: 5' cap amino acid aminoacyl tRNA synthetase anticodon codon EF-Tu-GTP EF-Ts eukaryote Kozak…

A: Three process combined together to form a central dogma that is replication where copy of genetic…

Q: Which of the following is the LAST to join the bacterial translation machinery during the initiation…

A: Translation refers to the process through which an mRNA sequence is converted into the corresponding…

Q: The following enzyme has an exact integer number of turns. What is the length and amount of amino…

A: Enzyme are usually composed of proteins while some enzymes are ribozymes (RNA enzymes). Proteins are…

Q: Splice sites on mRNAs are located with the help of all of the following EXCEPT:   Question 9…

A: Introns are cut off at splice sites along a pre-mRNA sequence, and exons are connected at these…

Q: Researchers are studying the mechanism of the antibiotic chloramphenicol. They know that it prevents…

A: The protein is synthesized by the process of translation. It takes place in cytoplasm of cell.

Q: The eukaryotic cell is different from the prokaryotic cell. Outline the structural difference…

A: Cells  They are the basic, fundamental entity of life.

Q: Below is the double stranded DNA sequence of part of a hypothetical yeast genome encoding a very…

A: Introduction Transcription : It Is The Initial Stage In Gene Expression, Which Involves "The…

Q: transcription initiation site GCAGTGACCGGATATAACGAAGAGGAATGCCGTACAAA 5' UCCUUAC 3' Which of the…

A: Coding strand is the that strand of DNA whose sequence is identical to the mRNA sequence while…

Q: Select all of the factors in the list below that play a role in the translation initiation of…

A: Translation : It is the process in which ribosomes in the cytoplasm or endoplasmic reticulum…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.