List all single base substitutions that would change a codon for Leu to a nonsense codon. For each, indicate whether it would be a transition or transversion. Second base A UGU Туг Cys UGC C UAU UUU Phe UUC UCU UAC UCC Ser UCA UUA Leu UUG UAA Stop UGA Stop A UAG Stop UGG Trp G UCG CGU CCU CCC CUU CUC CUA CAU His CAC Pro CAA Gln CAG Leu CCA CG CGC Arg CGA 2CUG CGG E AUU AGU Ser AGC ACU AAU Asn AAC Thr AAA Lys AAG AUC Ile ACC A. AUA AUG Met ACG AGA Arg AGG ACA G GUU GCU GCC GUC Val GCA GUA GUG GGU GAU Asp GAC Ala GGC Gly GGA GAA Glu GAG GCG GGG UCAG Third base

Q: Yeast have 8 similar tRNA genes with the anticodon 5’-GUA. A researcher mutates one of these genes…

A: Tranafer RNA helps in transporting amino acid as per the instructions given by messenger RNA during…

Q: please answer the question provided in the picture about the black allele gene asap please

A: INTRODUCTION Translation is the process of translating the sequence of a messenger RNA (mRNA)…

Q: Consider the following 2 codons sequences. Codon sequence 1:  ACU AGA GAU GUC UGC Codon sequence…

A: β-sheets are formed by adjacent parallel or antiparallel peptide strands that are hydrogen bonded in…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: Describe the anticodon of a single tRNA that could recognize the codons 5′–AAC–3′ and 5′–AAU–3′.…

A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…

Q: The following sequence represents a few codons present in one strand of DNA.Using this strand of DNA…

A: DNA replication is the process of formation of copies of DNA. It takes place in nucleus of cell.…

Q: eseg pL oseg sy non UCC UAU sko C. UAC UGA dos UGG UUA UCA UAA dois dois CGU ne UAG UCG dil CAU CUC…

A: Genetic code The combination of three nucleotides called codon . Each codon codes for an amino acid…

Q: Use the genetic code table to determine the amino acid sequence of the given message strand of DNA…

A: Proteins are made up of amino acids, which are a type of molecule. The basic components of life are…

Q: Shown below is a hypothetical RNA molecule. Which of the following corresponds to the template DNA…

A: RNA is produced from the DNA template by the process known as transcription that occurs within the…

Q: 9) In another mutation from the original wild-type sequence, the bolded G in the middle of the…

A: The DNA is transformed into proteins through the process of transcription and translation.  The…

Q: For the below sequence, where the +1 site is in bold underline and the +10 and -10 sites are also…

A: Option 1 i.e. 5' AUA 3' is the correct answer.

Q: Below is the sequence of an mRNA that has just been transcribed. Please translate this sequence as…

A: Let's rearrange the mRNA in the codes of three.  ACG UCC AAU GGC AGU GAU UUG AAU CCA ACG codes for…

Q: The E site may not require codon recognition. Why?

A: The translation is the process, during which protein is synthesized from mRNA sequence. The mRNA…

Q: Imagine you are going to label a gene associated with apoptosis in Symbiodiniaceae with a Yellow…

A: Exons are coding sequences and introns are the non-coding sequences. Splicing is the process of…

Q: A normal mRNA that reads 5'- UGCCAUGGUAAUAACACAUGAAGGCCUGAAC-3' was an insertion mutation that…

A: mRNA Messenger RNA or mRNA, it is a single-stranded RNA molecule that is coded into chain of peptide…

Q: The tollowing mRNA transcript would result in which polypeptide sequence? 5'-ACU UUC ACU AUG UUU UUA…

A: Protein consists of amino acids linked by amide bonds or peptide bonds.

Q: Second letter A G UUU Phenyl- UUC alanine UAU UAC UGU UGC Oysteine UCU Tyrosine UCC Serine UUA UUG…

A: The genetic codon present in the mRNA will be translated during the translation process by ribosome…

Q: translation

A:

Q: * Part of a sequence of DNA from a person without this genetic disease is: TAG TAA AAA CCA CCC AGG…

A: Anticodons are nucleotide sequences that are the opposite of codons. They're located in tRNAs, and…

Q: Which of the triplets below is a possible anticodon for a tRNA that transports Leucine (Leu) to a…

A: DNA => Transcription => mRNA => Translation => Protein Protein synthesis is ribosome…

Q: A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid…

A: Mutation is defined as sudden inheritable change that occurs in the DNA sequence. It may be…

Q: Q3. Cystic fibrosis is an autosomal recessive inherited disorder that causes severe damage to the…

A: Hi there! Since you have posted multiple questions, we are answering only first three sub-parts.…

Q: transcription initiation site GCAGTGACCGGATATAACGAAGAGGAATGCCGTACAAA 5' UCCUUAC 3' Which of the…

A: Coding strand is the that strand of DNA whose sequence is identical to the mRNA sequence while…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.