For the below sequence, where the +1 site is in bold underline and the +10 and -10 sites are also labeled, what are the first 3 nucleotides of the RNA transcribed from this sequence? +1 510 +10 3' GAGCGACATAATACGATTAT 5' AUA 3' 5' AAU 3' 5' UAU 3' 5' UUA 3' 5' CUA 3'

For the below sequence, where the +1 site is in bold underline and the +10 and -10 sites are also labeled, what are the first 3 nucleotides of the RNA transcribed from this sequence? +1 510 +10 3' GAGCGACATAATACGATTAT 5' AUA 3' 5' AAU 3' 5' UAU 3' 5' UUA 3' 5' CUA 3'

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Related questions

Q: The following sequence represents the dsDNA code for a short peptide 5' -CTT TCC CAT CAC CGC ATG…

A: 3= No , it is not possible for codon to code for another amino acid . 4= UAA is a stop codon , if…

Q: Describe the anticodon of a single tRNA that could recognize the codons 5′–AAC–3′ and 5′–AAU–3′.…

A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…

Q: Using the Genetic Code Table in Figure 1.3, what is the proper sequence of amino acids in the…

A: DNA ( Deoxyribonucleic acid ) is two stranded ladder like structure which act as genetic material in…

Q: Please draw the pre-mRNA that would be produced from this gene.Gray nucleotides indicate noncoding…

A: In transcription, the template strand is the strand of DNA that serves as the template for the…

Q: A wildtype gene produces the polypeptide sequence: Wildtype: Met-Ser-Pro-Arg-Leu-Glu-Gly Each of the…

A: To explain--M1: Met-Ser-Ser-Arg-Leu-Glu-GlyThis mutation involves the substitution of Pro with Ser.…

Q: 5' guanine cap 5' AUGCCGAUGCCUCCUAUCAGAUAAAAUAAA poly A tail AAAA 3' During DNA replication, a…

A: The mutation is the sudden and abrupt change in the structure and function of the chromosomes.

Q: About 98% of the E. coli genome codes for proteins, yet mRNA, the template for protein synthesis,…

A: In order for a gene to be converted into a functional protein, it has to undergo two processes…

Q: ginine rine ginine cine Third letter DCAG UCAG UCAG

A: There are 64 possible codon out of which 3 codon do not code for any amino acid. Thus 61 codon code…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: What is the peptide encoded by this mRNA sequence 5’-UCG-GCA- AAU-UUA -GUU-3’?

A: m-RNA consist of 5' to 3' direction as it is synthesized from the dna template in the 5' to 3'…

Q: The following RNA polymer is added to an E. coli extract, where it can be translated in all three…

A: A reading frame is the sequence of nucleotides in a nucleic acid (DNA or RNA) molecule read into a…

Q: The DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are…

A: The transcription is the process in which the mRNA copied information from DNA for protein…

Q: What is the peptide encoded by this mRNA sequence 5’-UCU-GCA- AAU-UUA -GUU-3

A: RNA (Ribonucleic acid) polymerase is the major enzyme responsible for the transcription process in…

Q: 26) The accompanying drawing represents simultaneous transcription and translation in E. coli. The…

A: Protein synthesis takes place in two stages, namely, transcription and translation. Transcription is…

Q: in m 5'- 3'- Shown below is a schematic diagram illustrating a very short gene with 3000 bp region…

A: Transcription is the process of formation of transcript that is mRNA from DNA. It is catalysed by…

Q: Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic…

A: An exon is any part of a gene that will encode a part of the final mature RNA produced by that gene…

Q: Select one: O Met-Cys-Ala-Thr-Tyr---- O Met-Cys-Cys-Thr-Tyr--- O Met-Ala-Ala-Thr-Tyr---- O…

A: Aminoacyl tRNA synthetase are enzymes of extreme importance during the process of protein synthesis…

Q: What is the net charge of the peptide at pH 7 that is synthesized from this DNA sequence? 5'…

A: As we know that the DNA sequence exhibits codons, which helps in the formation of mRNA, and then…

Q: Shown below is a hypothetical RNA molecule. Which of the following corresponds to the template DNA…

A: RNA is produced from the DNA template by the process known as transcription that occurs within the…

Q: 14.18) Write the three-letter abbreviations for the amino acid residues, in order from N-terminus to…

A: It is important to know how DNA and RNA work together to make proteins. In transcription, DNA helps…

Q: how do you translate this sequence RNA A C U G U C A U G A G C C C U G C A…

A: Translation is the process by which proteins are synthesized by the ribosomes after the process of…

Q: What will be the overall anti-codon sequence in tRNA for this mRNA?…

A: Proteins are synthesized from DNA in two step process. These two processes are transcription and…

Q: By comparing Figures 8-16 and 8-17 with Figure 8-18,speculate what features of RNA permit…

A: The features of RNA that permit self-splicing (that is, in the absence of proteins)is that RNA is…

Q: List all single base substitutions that would change a codon for Leu to a nonsense codon. For each,…

A: Mutation: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to…

Q: Why is it important that the correct reading frame is used?

A: DNA contains both coding and non-coding region where introns are non-coding regions and exons are…

Q: For the following sequence please design an 18 base pair REVERSE primer. ATG TCA AAA GCT GTC GGT…

A: Primers are short single-stranded nucleic acid sequences that bind onto template strands and added…

Q: The following RNA: 5 AUGAUAACACUCGUACCUUAAUGUS' in the 5'-3'frame will betranslated into a peptide…

A: The single-stranded ribonucleic acid (RNA) molecule that corresponds to the genetic sequence of a…

Q: The wobble pairing rule states that a 'U' in teh anticodon wobble position can pair with 'A' or 'G',…

A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…

Q: Describe the prokaryotic translation initiation shown in the diagram. Define the convention of…

A: In bacteria initiation factor are required .Initiation factor 3(IF3) prevents 30S subunit binding to…

Q: Second letter A G UUU Phenyl- UUC alanine UAU UAC UGU UGC Oysteine UCU Tyrosine UCC Serine UUA UUG…

A: The genetic codon present in the mRNA will be translated during the translation process by ribosome…

Q: For Each of your 3 DNA Templates, Fill out the Following: DNA Template # DNA sequence (copy from the…

A: The process of gene expression involves transcribing DNA into mRNA and then translating mRNA into an…

Q: Provide the sequences of the template and coding strands of a DNA double helix that was used to…

A: Introduction :- The template strand is a strand of DNA that serves as the blueprint for the…

Q: While helix-turn-helix (HTH) is known to be involved in both eukaryotic and prokaryotic…

A: helix-turn-helix (HTH) is a DNA-binding motif found in a variety of proteins, including…

Q: The DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are…

A: A genetic code is a table consisting of 64 codons each of which code for specific amino acids. These…

Q: For the following sequence please design an 18 base pair forward primer.…

A: >> To make a primer, the pairing of bases goes as follows: A binds with T and T binds with A G…

Q: What type of RNA is involved in the post-transcriptional modification illustrated below? 5' 5' 3' 5'…

A: Post transcriptional modification is a very important step in an eukaryotic cell, where the primary…

Q: For the ovalbumin gene shown, indicate the locations of the following: (a) transcription start site,…

A: The transcription start site is the site on the DNA from which the first RNA nucleotide (+1) is…

Q: transcription initiation site GCAGTGACCGGATATAACGAAGAGGAATGCCGTACAAA 5' UCCUUAC 3' Which of the…

A: Coding strand is the that strand of DNA whose sequence is identical to the mRNA sequence while…

Question

For the below sequence, where the +1 site is in bold underline and the +10 and -10
sites are also labeled, what are the first 3 nucleotides of the RNA transcribed from this
sequence?
+1
5.10
+10
3
GAGCGACATAATACGATTAT
5' AUA 3'
5' AAU 3'
5' UAU 3'
5' UUA 3'
5' CUA 3'

Expert Solution

Answer

Option 1 i.e. 5' AUA 3' is the correct answer.

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

What are two possible anticodon sequences for tRNA's that are charged with Phenylalanine (Phe)? O 3' AAU 5' and 3' GAA 5' O 3' AAA 5' and 3' AAG 5 3' UUG 5' and 3' CUG 5' O 3' GAA 5' and 3' CAG 5' 3' GUA 5' and 3' GUG 5'
What is the peptide encoded by this mRNA sequence 5’-UCU-GCA- AAU-UAA -GUU-3’?
Why RNase H cannot remove all the RNA residue from Okazaki fragments to form a lagging strand? Explain.
Consider the following mature mRNA from a human cell: 5' UAAUGUCGCAAUAACC 3¹ What is the sequence of amino acids in the translated protein? Second letter A First letter С U d A G บบบ UUC P U UUA UUG Leu CUU CUC CUA CUG GUU GUC GUA GUG -Phe Met-Ser-Gln Met-Arg-Lys-Ser Leu Stop-Cys-Arg-Asn-Asn C AUU AUC lle AUA ACA AUG Met ACG Val UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC GCU GCC GCA GCGJ Ser Pro Thr Ala UAU UAC Tyr UGU UGC. UAA Stop UGA Stop UAG Stop UGG Trp CAC CAGGin CAU His Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. AAU Asn AAA Lys AAG. There is no start codon, resulting in no translated protein. GAU ASP GAC Glu GAA GAG G CGU CGC CGA CGG Cys AGU AGC AGA AGG Arg GGU GGC GGA GGGJ Arg ser Gly MCAG U UCAG с А SCAG U SCAG U Third letter
Using the genetic code below, decipher the following mRNA sequence. 5'CCCGGGAUGCGGUGUUGGUUUUAACCCGGG3' (show all work)
Diagram the likely secondary structure of an RNA with the sequence
Please fill out the following table. Circle sense or template strands. Indicate 5’, 3’, amino and carboxy ends. Use wobble whenever possible
If an antisense RNA is designed to silence the following mRNA sequence, which of the following antisense oligos (a-d) could be used for this purpose? mRNA sequence: 5' UAGGACUAUUAAGGUACACCCAUU 3' O 5' AUCCUGAUAAUUCCAUGUAAAUAA 3' O 5' AAUGGGUGUACCUUAAUAGUCCUA 3' O 5' UAGGACUAUUAAGGUACACCCAUU 3' O 5' UUACCCACAUGGAAUUAUCAGGAU 3¹
Please answer A, B, and C for codon sequence 4 only
A series of tRNAs have the following anticodons. Consider the wobble rules listed in Table and give all possible codons with which each tRNA can pair. Q. 5′ –CAG–3′
Several experiments were conducted to obtain information about how the eukaryotic ribosome recognizes the AUG start codon. In one experiment, the gene that encodes methionine initiator tRNA (tRNAiMet) was located and changed; specifically, the nucleotides that specify the anticodon on tRNAi Met were mutated so that the anticodon in the tRNA was 5′ –CCA–3′ instead of 5′ –CAU–3′. When this mutated gene was placed in a eukaryotic cell, protein synthesis took place, but the proteins produced were abnormal. Some of these proteins contained extra amino acids, and others contained fewer amino acids than normal. a. What do these results indicate about how the ribosome recognizes the starting point for translation in eukaryotic cells? Explain your reasoning. b. If the same experiment had been conducted on bacterial cells, what results would you expect? c. Explain why some of the proteins produced contained extra amino acids while others contained fewer amino acids than normal
Please answer A, B, and C for codon sequence 1 only