Design 6 bp primers to amplify the region of this sequence that is highlighted in yellow. 1 attatatttt atattatata ctctgggctc agagcagccc 40 41 atattatata tatatatttt aaaatattat aaatttattt 80 81 cagtcacgcg tcctgatgac attatatttt ataatttttt 120 121 ttttattttt attatatttt aaaatattat aaatttattt 160 161 aaaatattat tatatattta aaatttattt attataaaat 200 201 aaaatattat ttttattttt gagatcagga cggctgcatg 240 Forward primer Reverse primer

Q: Help me figure out how I should interpret and read these graphs. We are looking to see whether the…

A: The regulation of RNA splicing is a complex process that involves the interaction of multiple…

Q: For the following sequence design the forward and reverse primer... explain and justify your answer.…

A: A primer is a short, single-stranded DNA or RNA sequence that initiates DNA synthesis. In PCR,…

Q: What is thee tRNA anticodon for the first 5’-ACGAUC-3’?

A:

Q: A 210-bp sequence within the CFTR gene on human chromosome 7 is shown below. The three bold…

A: A primer is a short DNA sequence that serves as a starting point for DNA synthesis in a polymerase…

Q: 6. Refer to the figure answer the following questions. CLUSTAL W (1.83) multiple sequence alignment…

A: DNA is the genetic material for many multicellular organisms. The DNA present in all organisms is…

Q: What are the functional consequences of this deletion for lilP mRNA transcription and translation?…

A: Introduction :- A deletion mutation is a type of genetic mutation that involves the loss of one or…

Q: 2) The partial coding sequence of the Spike protein for SARS- COV-2 is shown below: You are tasked…

A: The answer is option A  In the PCR amplification, two primers are used to flank the target region to…

Q: 4.08 2.54 H Note: E E 1.02 1.02 1.67 H = EXON = INTRON AE E 10.8 kbp 3.94 3.66 E = EcoRI site H =…

A: Autoradiography is a method that visualizes molecules or fragments of molecules that have been…

Q: Name TWO functions of the 5'UTR.

A: Solution The 5' UTR plays important role in stability, processing and localisation of mRNA.  5' UTR…

Q: In sequencing, dideoxyribonucleotides (ddNTP) are used that terminate the amplification. Why do they…

A: Introduction : DNA sequencing is the process by which the specific sequence of the four nucleotide…

Q: If a point substitution mutation changes the sequence 5'ATGAAA3' to 5'ACGAAA3' in the MIDDLE of the…

A: Point mutation is a genetic mutation in which a single nucleotide base is altered, inserted or…

Q: I was wondering if it is possible to provide an explanation on the structure of the PDB code 2V1X,…

A: Each PDB code represents a unique identifier for a particular protein structure. The PDB code is…

Q: You are analyzing the region of DNA shown below to determine how many AATG repeats are present. To…

A: In PCR, forward and reverse primers are to  be added. PCR involves denaturation, annealing and…

Q: The most common MCAD mutation is shown below. The coding strand is shown for both the WT and mutant.…

A: 5’ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGCATAGCATACTGAGGGTAGTAG-3’…

Q: 4) Consider three different kinds of human libraries: a genomic library, a brain cDNA library, and a…

A: Genomic deoxyribonucleic acid (gDNA) is representative of the chromosomal DNA present in the cells…

Q: the one above: Replicate this sense strand to create a double-stranded DNA helix…

A: DNA is a double helical structure containing complementary base pairs.  Complementary base pairs…

Q: Below is the sequence of the yeast S cerevisiae GCN4 gene including 100 bp upstream and 100 bp…

A: Introduction to the topic of introns:Introns are non-coding regions of DNA that are transcribed into…

Q: What restriction enzyme (or enzymes) would you use to cut the following...   (Gene of Interest is…

A: Forward Primer:5'-TCTAGAGTCAATGAAACAACA-3'Explanation:This sequence starts with the same…

Q: Question 7. What is the sequence of the primary transcript produced from this gene? -35 sequence…

A: A gene is a stretch of DNA that codes for a polypeptide chain and is transcribed into mRNA.

Q: Based on the following wild type sequence, indicate if each of the mutations should be classified as…

A: Mutations are changes in the sequence of DNA which may or may not affect the phenotype of the…

Q: Based on the following wild type DNA sequence, indicate if each of the mutations should be…

A: A mutation is a change in a DNA sequence. Mutations can result from DNA copying mistakes made during…

Q: Transposons in bacterial genomes can carry genes,including those conferring ________ resistance

A: The transposable elements are known as stretches of DNA molecules that can jump from one place to…

Q: Decide on two restriction sites that you can use to clone this into pL4440’s MCS. Identify their…

A: DNA cloning restriction sites are specific DNA sequences recognized and cleaved by restriction…

Q: For the following sequence please design an 18 base pair forward primer.  ATG TCA AAA GCT GTC GGT…

A: Introduction :  Primers are short oligonucleotides that are chemically synthesised and complementary…

Q: b. Which one of the following a cell mutants will be able to switch at least once? [Select]

A: Alpha (α) thalassemia is a genetic problem and is brought about by cancellations or transformations…

Q: 1 agagtctcct cagacgccga gatgctggtc atggcgcccc gaaccgtcct cctgctgctc 61 tcggcggccc tggccctgac…

A: Annotating a genome involves finding functional components throughout its sequence in order to give…

Q: Corn_AA DVVINHRCA---DYKDGRGIYCVFEGG---TPDSRLDWGPDMICSDDTQYSN--GRG 16 :: Figure: Sequence alignment…

A: Sequence alignment is defined as the arrangement of sequences of DNA, RNA, proteins to identify…

Q: would the J3480 Code and 59 Modifer Code go on seperate lines under the HCPCS Level II codes column?

A: HCPCS Code: J3480 - Injection, Marcaine, 30 mlModifier: 59 - Distinct procedural service (to…

Q: Decide on two restriction sites that you can use to clone this into pL4440’s MCS. Identify their…

A: The recombinant DNA technology use plasmid to transfer foreign DNA into the host organism in which…

Q: These sequences are derived from the middle region of the covid-19 spike protein. Which choice or…

A: trypsin digest is used to cleave the proteins in a sample downstream to every K (lysine) or R…

Q: Below is a set of sequence reads from an individual aligned to a reference sequence. AGACACTCCACC…

A: Homozygous SNPs - has multiple possible alleles - 1 Heterozygous SNPs - has specific insertions or…

Q: TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT Compare this mutated sense…

A: ORIGINAL:- TGAGGATGAAACTCACACCGGGGCGCAAGTTTGGCACTTAGATTCTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT…

Q: 5' ATGATCTCGTAA 3' 3' TACTAGAGCATT 5'

A: DNA, or deoxyribonucleic acid, is a hereditary molecule that encodes the blueprint for the growth,…

Q: a b A-T (FT169) Vector IR (10 Gy): WT Wortmannin: IR (10 Gy) cap T2609 «DNA-PKcs 1 2 3 1 2 3 4 Ku80…

A: Phosphorylation of a molecule is the process of attachment of phosphoryl group.