If a point substitution mutation changes the sequence 5'ATGAAA3' to 5'ACGAAA3' in the MIDDLE of the coding region, what is the most likely Second letter result? UCU UCC UCA UUG Leu UcG UUU Phe UAU UAC Tyr UGU Cys UGC UAA Stop UGA Stop UAG Stop UGG Trp G UC Ser UUA CUU CAU CAC CCU CGU CGC CGA CỤC Leu CCA CUA CCC Pro His CAA Arg CUG CAG Gin CCG CGG AUU ACU AAU) AAC Asn AGC Ser Thr AAA1 AAG Lys AGG Arg AGU AUC lle ACC AUA ACA AUG Met ACG AGA GCU GCC GCA GUU GAU) GAC Asp GGC Ala GGU GUC Val G GUA GAA1 GGA Gly Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. no protein is made no effect protein has altered amino acid sequence protein is not made because of frameshift mutation Third letter First letter

Q: al mRNA: 5’- AUG GGC UCG ACC UUG -3’ Mutant mRNA 1: 5’- AUG GGC UAG ACC UUG -3’ Mutant mRNA 2: 5’-…

A: The physical and functional unit of heredity is the gene. They pass on knowledge from one generation…

Q: Eukaryotic transcription requires a "cap" at one end and a "tail" at the other end of each mRNA…

A: Eukaryotic transcription is the process that eukaryotic cells use to copy genetic material through…

Q: Which of the above mutations will result in a shift in the reading frame

A: Mutations in a cell can be of several types: Chromosomal mutations - where one of the chromosomes in…

Q: sgRNA GFP Exon 1 Exon 1 Intron 1 Exon 2 Exon 2 Intron 2 Exon 3 Intron 3 Exon 4

A: Messenger RNA (mRNA) is a cellular component that transports instructions from DNA in the nucleus to…

Q: You would like to use a CRISPR-Cas system to knockout a gene that includes the following sequence:…

A: CRISPR (Clustered regularly interspaced short palindromic repeats)-Cas is a gene-editing tool. It…

Q: Mutant #    Deletion Region    %Transcription (lungs)  %Transcription(kidneys) WT…

A: The genes that are expressed in a variety of organs in the body are the general-purpose genes. Such…

Q: A 210-bp sequence within the CFTR gene on human chromosome 7 is shown below. The three bold…

A: A primer is a short DNA sequence that serves as a starting point for DNA synthesis in a polymerase…

Q: Which statement describes a difference between transcription in eukaryotic and prokaryotic cells?

A: The process of DNA based gene expression in which a particular sequence of DNA molecules are copied…

Q: 3) mutated:3' TA C A CC TTG coA CGA CTA'S MRAA transcript: AuG uCG AACGCU Gcu GAu. amino acid:…

A: A mutation is a change in the DNA sequence of an organism. Mutations can result from errors in DNA…

Q: If the template DNA is 3' A GCTAC5' then the mRNA sequence is

A: Ans- As mentioned the DNA template 3’ – A G C T A C – 5’ The mRNA sequence will be – a)          5’…

Q: Name TWO functions of the 5'UTR.

A: Solution The 5' UTR plays important role in stability, processing and localisation of mRNA.  5' UTR…

Q: The most common MCAD mutation is shown below. The coding strand is shown for both the WT and mutant.…

A: 5’ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGCATAGCATACTGAGGGTAGTAG-3’…

Q: Tay Sachs disease is an autosomal recessive disease in which a protein – Hex A - is abnormal. To…

A: Molecular Biology is the branch of biology that deals with a study of the composition, arrangement,…

Q: The following RNA polymer is added to an E. coli extract, where it can be translated in all three…

A: A reading frame is the sequence of nucleotides in a nucleic acid (DNA or RNA) molecule read into a…

Q: None

A: Thes images is only for reference purposes

Q: missense,

A: 1. Non- conservative missense mutation occur , when G was substituted with C .

Q: Based on the following wild type sequence, indicate if each of the mutations should be classified as…

A: Mutations are changes in the sequence of DNA which may or may not affect the phenotype of the…

Q: Describe the mutation that occurs in the following examples (be specific, if possible): BOAT  to BAT…

A: Mutations are changes or alterations or modifications in the nucleotide sequence of the genome or…

Q: When an EcoR1 fragment, which represents the coding region of a human gene X, is cloned into the…

A: Fusion proteins are created by combining two or more genes into a single gene. GST is a common…

Q: You have the following DNA coding sequence of a wild-type allele: 5’-ATG TTC CAG CTA GAT GAT ATG CTG…

A: DNA coding sequence of a wild-type allele: 5’-ATG TTC CAG CTA GAT GAT ATG CTG GTA ATT GGG GAA CGC…

Q: Upon going through the complete process of gene expression, which amino acid would be most likely to…

A:

Q: Below is a diagram of an Oscar Miller (Christmas tree) spread. Which of the following is true? O a.…

A: Transcription is the second step of central dogma in gene expression involving the synthesis of RNA…

Q: If the promoter is here and transcription starts here…

A: Transcription is the process of formation of RNA using DNA as a template.

Q: What is reverse transcription simple definition?

A: The process by which generation of new proteins in a cell takes place is known as protein synthesis.…

Q: Identify the type of point mutation on the following strands (transition or transversion):  a. 5’…

A: The mutation is the sudden deleterious effects in the DNA sequences, they can arise when the DNA is…

Q: Original DNA sequence: mRNA transcript: amino acids: Mutated DNA sequence #3: mRNA transcript:…

A: This practice sheet is about transcription and translation. Transcription is a process in which mRNA…

Q: Look at the sequence of TAS2R38 (Fig. 4.10 of your module and below). The numbers at the beginning…

A: In molecular biology, DNA sequences are the blueprint of life, encoding the instructions for…

Q: In Sickle Cell Disease, the 6th amino acid after the START codon is different than it is in wildtype…

A: A mutation is a permanent alteration or change in the nucleotide sequence of DNA (deoxyribonucleic…

Q: (11) If you design a gRNA with the sequence, GGU AUC AUU GCA CUG ACC AG, in theory which position of…

A:

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.