In the table below, there are four versions of gene A, one of which is normal, and the other three which contain mutations that make the gene product nonfunctional. Focus on the shaded region of the sequence. Use the genetic code table to answer the question. How would you describe Mutation #2? Partial DNA sequence for gene A ("..." indicates many nucleotides of sequence not shown) Normal 5' .. ATG GTG AGC AAG GAG GAG CTG TTC ACC TGT AAA TAG ... Mutation #1 5' ... ATG GTG AGC AAG GAG AAG CTG TTC ACC TGT AAA TAG ... Mutation #2 5' ... ATG GTG AGC AAG TAG GAG CTG TTC ACC TGT AAA TAG Mutation #3 5' ... ATG GTG AGC AAG GAG CTG TTC ACC TGT AAA TAG ... Silent mutation O Nonsense mutation O Frameshift mutations O Missense mútation

In the table below, there are four versions of gene A, one of which is normal, and the other three which contain mutations that make the gene product nonfunctional. Focus on the shaded region of the sequence. Use the genetic code table to answer the question. How would you describe Mutation #2? Partial DNA sequence for gene A ("..." indicates many nucleotides of sequence not shown) Normal 5' .. ATG GTG AGC AAG GAG GAG CTG TTC ACC TGT AAA TAG ... Mutation #1 5' ... ATG GTG AGC AAG GAG AAG CTG TTC ACC TGT AAA TAG ... Mutation #2 5' ... ATG GTG AGC AAG TAG GAG CTG TTC ACC TGT AAA TAG Mutation #3 5' ... ATG GTG AGC AAG GAG CTG TTC ACC TGT AAA TAG ... Silent mutation O Nonsense mutation O Frameshift mutations O Missense mútation

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Related questions

Q: A gene contains 30% thymine. What is the percentage of pyrimidines present in this segment? Explain.

A: Purines and pyrimidines are chemical molecules that play a role in the production of DNA and RNA and…

Q: There are dozens of common variations of the c-myc gene, which are associated with different types…

A: The mRNA is produced from the DNA by the transcription process and this mRNA is used for the protein…

Q: 5. Assume that you are trying to do a gel mobility shift experiment using a normal set of Trp genes.…

A: The gel mobility shift assay is a biochemistry technique used to detect protein complexes with DNA.…

Q: please answer the question provided in the picture about the black allele gene asap please

A: INTRODUCTION Translation is the process of translating the sequence of a messenger RNA (mRNA)…

Q: 1 tctagagtca tgaaacaaca aaaacggctt tacgcccgat tgctgacgct gttatttgcg 61 ctcatcttct tgctgcctca…

A: Forward Primer:5'-TCTAGAGTCAATGAAACAACA-3'Explanation:This sequence starts with the same…

Q: type of mutation

A: If the sequence was mutated from CACGTAAAG to become CACCGTAAAG; single nucleotide insertion…

Q: Using the first and second base key below, predict the DNA sequence given by the SOLID color…

A: Answer:- Nitrogenous bases are crucial components of nucleotides, which are the building blocks of…

Q: In addition to the standard base-paired helical structures, DNA can form X-shaped hairpin structures…

A: Cruciform DNA is a form of non-B DNA that requires at least a 6 nucleotide sequence of inverted…

Q: The most common MCAD mutation is shown below. The coding strand is shown for both the WT and mutant.…

A: 5’ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGCATAGCATACTGAGGGTAGTAG-3’…

Q: Transposons are useful as mutagens because they act asmolecular tags for genomic DNA sequences that…

A: Step 1 Transposons or jumping gene is a DNA (deoxyribonucleic acid) sequence that can change its…

Q: 9. (2) Here is a sequence of double stranded DNA. Choose a pair of primers to amplify gene X.…

A: Polymerase Chain reaction or PCR is a rapid in vitro technique for amplifying target DNA…

Q: Describe the mutation that occurs in the following examples (be specific, if possible): BOAT to BAT…

A: Mutations are changes or alterations or modifications in the nucleotide sequence of the genome or…

Q: If I'm understanding your explanation correctly, do you mean that option D "At the 3’ end of the…

Q: Would a gain of function mutaion that occurs in the first exon of a gene with twelve exons more…

A: Gain-of-function type of mutation is a mutation in which the altered gene product possesses a new…

Q: The figure shows the position of two of these mutations a and b. The nucleotides are altered in…

A: Note: Your question has 4 sub parts and as per our instructions we ara able to answer only three.…

Q: Given that there are about 20,000 human genes, how can human cells make 75,00o-100,000 different…

A: Given questions: How human cells make different proteins Difference between missense and nonsense.…

Q: The restriction endonuclease NciI recognizes and cuts the five-base-pair sequence 5’- CC(G/C)GG-3’…

A: Introduction: A bacterial protein termed restriction enzyme, also known as restriction endonuclease,…

Q: As a hobby you propagate a population of worms. You notice that one worm is now clear instead of…

A: Deletions are mutations in which a section of DNA is lost, or deleted. Since protein-coding DNA is…

Q: Explain exactly what the X25 probe is and how it allows for visualization of mRNA from the patients.…

A: Frataxin is a mitochondrial protein responsible for iron binding. When the expression of this…

Q: In the absence of this enzyme, a substance called ceroid lipofuscin accumulates in lysosomes in the…

A: CRISPR is a DNA sequence that found in prokaryotic organism's genome like bacteria , archaea.…

Question

In the table below, there are four versions of gene A, one of which is normal, and the
other three which contain mutations that make the gene product nonfunctional.
Focus on the shaded region of the sequence. Use the genetic code table to answer
the question.
How would you describe Mutation #2?
Partial DNA sequence for gene A ("..." indicates many nucleotides of sequence not
shown)
5' ... ATG GTG AGC AAG GAG GAG CTG TTC ACC TGT AAA TAG ...
Normal
Mutation #1
5' ... ATG GTG AGC AAG GAG AAG CTG TTC ACC TGT AAA TAG ...
Mutation #2
5' ... ATG GTG AGC AAG TAG GAG CTG TTC ACC TGT AAA TAG ...
Mutation #3
5' ... ATG GTG AGC AAG GAG CTG TTC ACC TGT AAA TAG ...
Silent mutation
Nonsense mutation
Frameshift mutations
Missense mútation

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

You are working in the lab with two known carcinogens found in cigarette smoke: Benzo(a)pyren (BaP) and nitrosamine ketone (NNK). BaP is an aromatic hydrocarbon and the mechanism of carcinogenesis is through oxidation reactions with DNA. NNK is a nitrosoamine. Describe how these two kinds of carcinogens lead to mutations. (Be detailed. Remember you are graded on effort/completeness.)
THE MOLECULAR GENETICS OF SICKLE CELL ANEMIA The following is the base sequence of DNA that codes for first eight amino acids of the B chain of hemoglobin. The B chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene. DNA Template Strand: TACCACGTGGACTGAGGACTCCTC 1. What is the minimum number of DNA nucleotides in this whole gene? 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 3. What mRNA will be formed from the template strand of DNA? 4. What amino acids will this mRNA code for? 5. If the 20th base in the template strand of the DNA is changed from T to A, rewrite the new template strand below. 6. When the template strand of the DNA is changed, this is referred to as a mutation. What kind of mutation is this? 8. 7. What mRNA will be formed from the mutated template strand of DNA? What amino acids will this new mRNA from the mutated template strand code for? 9. Are these new amino acids the…
This shows where EcoR1 cuts, where HindIII cuts, and where BstEII cuts. Given that the entire chromosome is 48,502 base pairs (as it says), figure out the fragment sizes you will expect if you cut it with EcoR1, or with HindIII, or with BseEII. Draw a map like the example attached " Show the sizes of each piece. Color code it according to which enzyme cut it.
Sickle cell hemoglobin DNA CACGTAGACTGAGG ACAC.. Sickle cell hemoglobin MRNA Sickle cell hemoglobin AA sequence 4. What type of mutation is this? Please explain why.
Please in detail, what the picture attached represents
Based on standard MS- LS3-1: Fish in a cave system in Mexico is missing its eyes, has thin, translucent skin, and is relatively small (7-10 cm in length). Can you describe by model why structural changes to genes (mutations) on chromosomes may affect proteins and may result in beneficial effects to the structure and function of the fish? Can you answer in the following format? 1- Structure How Structure and Function is Affected by Mutations in Blind Fish Eyes Scales Taste Cells Lateral Line 2- Model to explain what causes these changes: Change: ______________ Adapting an Organism to the Dark Cause: ________________ Stop the Growth of Eyes Effect: ___________________ Fish with Heightened Other Senses References: Video: Rare Blind Cave Fish in Mexican Cave System https://www.youtube.com/watch?v=MWdtGuDd8z0 Fact Sheet: Blind Cave Fish https://www.denverzoo.org/animals/blind-cave-fish Information: Mexican Tetra…
In the image below, the blue squiggly line represents a folded protein. There are two particular amino acids that are colored red and black in the protein. The structure of each of these two specific amino acids is shown in the indicated box. A mutation occurs in the gene that encodes the protein illustrated above. The result of this mutation is that one of the amino acids above is substituted with another. Specifically, the amino acid whose structure is shaded red above (the one on the left in the illustration) is replaced by the amino acid shown below. Use this information to answer the two questions that follow. Please answer these questions. 1. Based on this description, indicate which type of mutation occurred: missense, nonsense, silent, or indel 2. How would this mutation affect this protein's structure and function? Explain in 2-4 sentences. Be specific, and be sure to include details of these specific amino acids in your response. (I'm giving you the…
You are studying a gene containing three exons (exon 1 = 66 nucleotides , exon 2 = 99 nucleotides , and exon 3 = 333 nucleotides ) that produces a primary RNA transcript 748 nucleotides long . Gel electrophoresis analysis shows different size mature transcripts are produced in three different cell types . The sizes of the mature transcripts are the following : 1. Neuronal nalcells = 498 nucleotides 2. Muscle cells = 600 nucleotides 3. Liver cells = 399nu nucleotides Primary RNA ranscript = 748 nucleotides a. Name the strategy that allows the same gene to produce different mature transcripts in different tissues . b. Describe the ways (or combinations of exons /introns ) used to produce each one ofthe three mature transcripts . Label the each mature transcripts and include its length . c. Indicate the length of the polypeptide encoded by each mature transcript
Transcribe and translate the mutated sequence #1. Determine the consequence, if any, for each mutation. You will need to use your codon charts in your ISN. Practice with both charts.
Which of the following mutations in the protein-coding region of a gene is more likely to lead to complete loss of function of the encoded protein: an insertion of six nucleotides or a deletion of two nucleotides? Briefly explain your answer.
Compute the PERCENT IDENTITY for the following pairwise sequence alignment. ACTGATGGGGG--AGACGTA ||||| ... I ||||||| ACTG--AAAAGCTAGACGTA