Mutant #    Deletion Region    %Transcription (lungs)  %Transcription(kidneys) WT                      None                     100%                                      100%  1                          1-200                    130%                                       130% 2                       250-400                   100%                                       100% 3                       500-800                     50%                                         50% 4                      950-1100                      0%                                        100%   1) For the following gene, you notice the following results when analyzing several muntants. What type of sequence (be specific) has been mutated in mutant 1? What type of sequence (be specific) has been mutated in mutant 3? What would we call this type of mutation?  What type of sequence (be specific) has been mutated in mutant 4?

Q: Sd) Even once a usable mRNA has been produced (transcribed and processed), there are still several…

A: Protein synthesis is one complex procedure taken up by the cell and that needs various components to…

Q: O a base substitution in an intron 5' splice site O a frameshift in an exon O a missense in an exon…

A: The answer to the question is  A frameshift in exon

Q: Mediator is not necessary to reproduce transcription initiation reactions in vitro. If you are…

A: In the study of eukaryotic gene expression, understanding the process of transcription initiation is…

Q: FACTORS AFFECTING BACTERIAL EXPRESSION SYSTEM

A:

Q: Describe the banding pattern seen in the gel. What does that tell you about the role of annealing…

A: Gel electrophoresis is a laboratory technique for separating charged molecules such as DNA, RNA, and…

Q: 5. Assume that you are trying to do a gel mobility shift experiment using a normal set of Trp genes.…

A: The gel mobility shift assay is a biochemistry technique used to detect protein complexes with DNA.…

Q: You complete a comparative transcriptomics experiment, where RNA from a plant sample grown in sandy…

A: The researchers compared the gene expression differences between plants cultivated in silty soil and…

Q: recombinant human insulin, produced by bacteria carrying a cloned insulin gene, is now the major…

A: Insulin is an important hormone, which is used for diabetes treatment as it help to reduce the blood…

Q: You discover a new gene cluster from a strain of the bacterium Streptomyces. The domains of the…

A: Polyketides(PKs) and non-ribosomal peptide hybrids(NRPS) are important class of natural products,…

Q: name and briefly describe two methods you could use to identify the changes in DNA sequence found in…

A: DNA mutations can have a wide range of consequences, including the development of genetic disorders,…

Q: Trinucleotide repeat expansions (TNREs) are associated with severaldifferent human inherited…

A: The trinucleotide repeat expansion is also called triplet repeat expansion. It is a DNA mutation and…

Q: In order to identify cis-regulatory elements for the BRC2 gene in Arabidopsis thaliana, you develop…

A: The region of non coding DNA that play a critical role in gene expression regulation is known as cis…

Q: To quantify the transcription product of a specific gene in E. coli, you may use (select all correct…

A: Introduction The Process Of Transcribing A Piece Of DNA Into RNA Is Known As Transcription.…

Q: | ampicillin resistance gene 5 restriction site 6 Origin of replication 7 Ligase 2 promoter 3 Xhol Ч…

A: Ans:-       Exon    is a region of DNA that is not transcribed. Restriction site is the location in…

Q: If a point substitution mutation changes the sequence 5'ATGAAA3' to 5'ACGAAA3' in the MIDDLE of the…

A: Point mutation is a genetic mutation in which a single nucleotide base is altered, inserted or…

Q: explain: The kelch repeat domain in the problem in-line" or "plug-in" type domain.

A: Protein is a type of biomolecule. It is made up of a polypeptide chain, which is a chain of amino…

Q: After Drosophila DNA has been treated with a restriction enzyme, the fragments are inserted into…

A: a) By preparing a probe using the actin amino acid sequence or using the actin gene sequence known…

Q: The structure of a typical pUC19/human DNA recombinant clone. Ensure that you clearly indicate the…

A: Plasmid vectors are circular and extra chromosomal DNA which are capable of self-replication.…

Q: In the Avery, McLeod, McCarty Experiment where supernatant from heat killed, virulent S Strain…

A: Avery, McLeod and McCarty experiment was used to determine the genetic material and its nature on an…

Q: You would like to create a mouse model of the human disease Huntington's chorea, a dominant disease…

A: According to the guidelines of Bartleby,Since you have posted multiple questions, the expert can…

Q: Match the following (most appropriate combinations): Gel filteration chromatography Electrophoresis…

A: 1) Gel filtration chromatography - separation of proteins in a column based on size. In this type of…

Q: Based on the following wild type DNA sequence, indicate if each of the mutations should be…

A: A mutation is a change in a DNA sequence. Mutations can result from DNA copying mistakes made during…

Q: 20 ORF for gene X e for gene X above has a hypomorphic mutation (which you name Mutation #1) that is…

A: Answer.) :-The given question presents an experimental scenario involving Gene X, which has a…

Q: To identify the following types of genetic occurrences, would acomputer program use sequence…

A: Introduction  With the advancements of Bioinformatics tools and sequencing techniques we can easily…

Q: In Figure 12-4, certain mutations decrease the relativetranscription rate of the β-globin gene.…

A: A promoter is the region of DNA where transcription is initiated. It provides a site for binding of…

Q: When an EcoR1 fragment, which represents the coding region of a human gene X, is cloned into the…

A: Fusion proteins are created by combining two or more genes into a single gene. GST is a common…

Q: You sequence the TBX1 gene from patients to diagnose if they have DiGeorge syndrome, and you find…

A: A chromosomal disorder where a small segment of 22 chromosomes is deleted. It is also an…

Q: The IMD2 promoter contains three upstream transcription start sites (TSS) that are utilized under…

A: Inosine monophosphate dehydrogenase (IMD2) is a key enzyme in the purine biosynthesis pathway that…

Q: 汽 (0 hope this picture, https://www.phys.kSu.edu/gene/photos/sd.html. 2 will help you imagine the…

A: Isolation is a microbiological technique in which individual bacterial colonies are separated from a…

Q: Has mutated terminal sequences and lacks a functional transposase or reverse transcriptase. Has…

A: Transposable elements (TEs) are DNA or RNA sequences that have the ability to relocate within a…

Q: During construction of a knockout mouse, a targeting vector is introduced into mouse embryonic…

A: Gene targeting is the technique of changing a specific sequence or gene at its location in a genome…

Q: 1 4 6 7 8. 9. Transcriptional stop sequence ТАTA box ATG TAA AUG UAA Here is a diagram of a human…

A: The process of transcription catalyzed by RNA Polymerase II in eukaryotes gives rise to the pre-m…

Q: in 3 5% Shown below is a schematic diagram showing a 3000 bp region of yeast genomic DNA. (Note:…

A: DNA:  The hereditary substance in humans and almost all other animals is DNA, or deoxyribonucleic…

Q: Q. Telomere is a typical heterochromatic region in eukaryotic genome. Choose an incorrect…

A: Telomeres are the ends of chromosomes and contain repeated DNA that runs in 5′ to 3′ direction at…

Q: Itransferases and analyze the cells after they at do you expect to find in the promoter of gene X?…

A: Hematopoietic stem cells (HSCs) resides within the bone marrow, which serves as niche for the…

Q: Some viruses, such as SV40, contain closed circular DNAs carrying nucleosomes. If the SV40 viral…

A: As we know that viral chromosome is circular in a structure having supercoiled DNA. This…

Q: A double mutant produced by uneven crossing-over contains two single nucleotide mutations that…

A: The mRNA or messenger RNA contain the genetic codon that are translated into polypeptide chain by…

Q: From the list given - choose all the regulatory sequences that you think would control the…

A: A regulatory sequence is a nucleic acid molecule segment that has the ability to increase or…

Q: In Figure 6-1,a. what do the yellow stars represent?b. explain in your own words why the…

A: Each gene has two copies, also known as alleles, where each allele contributes 50% to the protein…

Q: 5'-TTAGGGAACCCTCACTGAATGAATGAATG AATGAATGAATGAATGAATGAATGAATGAATGTTTGGGCAAATAAACGCTG-3' Re-type (or…

A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…

Q: You are studying the regulation of a bacterial gene (TolU) that encodes an enzyme that is necessary…

A: First, let's start with a definition. Promoter: It is the sequence of DNA that is required to turn…

Q: Now you have the gene sequence. Now you would like to clone it into an expression vector to grow up…

A: Answer. The majority of eukaryotic genes contain non-coding DNA. The genes tend to have a split…

Q: . Let’s say that you have incredible skill and can isolate the white and red patches of tissue from…

A: Mutation It can occur due to errors in DNA copying during cell division, ionising radiation…

Q: Great! Now you have the gene sequence. Now you would like to clone it into an expression vector to…

A: Vectors: It is a transporting vehicle carries foreign DNA into host cell for cloning and expression.…

Genomic studies

Genomic studies (genomics) is the study of the whole genome of an organism. Using bioinformatics and high-performance computing, genomic researchers examined massive amounts of deoxyribonucleic acid (DNA)-sequence data to discover variations or mutations that affect drug response, health, or disease. Genomics is a much younger discipline than genetics, having only emerged in the last few decades as a result of technological advancements in DNA sequencing and computational biology.