Q. Telomere is a typical heterochromatic region in eukaryotic genome. Choose an incorrect description about gene silencing in telomere. ① Methylation on H3K9 is an initiating event for heterochromatin formation in telomere ② Mutation of Rap1 will disrupt the heterochromatic formation in telomere ③ Region of heterochromatin can spread along the chromosome until inhibiting mechanisms stop it ④ Sir complex is the key factor that condenses nucleosome in telomere

Q: In moelcular genetics, initiation is often accomplished using proteins that prevent elongation.…

A: Initiation of a process in genetics is an important event. At this stage, cell prepare itself for…

Q: Early in development, most human cells turn off expression of an essential component of telomerase,…

A: Telomeres are complex nucleoprotein structures present in the tips of the chromosomes which protects…

Q: Mutant #    Deletion Region    %Transcription (lungs)  %Transcription(kidneys) WT…

A: The genes that are expressed in a variety of organs in the body are the general-purpose genes. Such…

Q: 4. 16B (Eukaryotes): Describe 4 factors that differentiate eukaryotic chromosomes/genome from a…

A: Nucleus is a chief controller of the cell which carries genetic instructions . It comprises of…

Q: a. What are all the transversions that can be made starting with the codon CGG?b. Which of these…

A: C<-> A, G   G<-> C,T   CGG transversion are the following   1 ACC   2 ACT   ЗАТТ   4 ATC…

Q: Which statement is FALSE? Group of answer choices   Histones are very conserved at the primary…

A: 2nd statementis false. H1 doesn't contain histone fold domain. H2A, H2B, H3 and H4 have HFD

Q: i. Mutant A has a single base pair substitution with the T/A being replaced with C/G base pair at…

A: The transcription unit has a coding strand and template strand. Out of these two strands, only the…

Q: If a SNP is found much more frequently in dogs with white fur than in dogs with black fur, the SNP…

A: Single nucleotide polymorphisms (SNPs) in GWAS are essential for understanding the genetic…

Q: I. The retinoic acid receptor (RAR) is a transcription factor that is similar to steroid hormone…

A: The retinoic acid receptor is a kind of receptor which can act as transcription receptor. There are…

Q: Extreme UV exposure leads to the SOS response in bacteria. By what mechanism does the SOS response…

A: The SOS response is a DNA damage response mechanism in bacteria that is activated when the cell is…

Q: Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA…

A: The core dogma notes that the sequence of learning most commonly found in our cells is: From…

Q: Compared to heterochromatin, euchromatin is O comprised of densely packed nucleosomes and with…

A: Heterochromatin is characterized as the region of the chromosome which is obscurely darkled stained…

Q: D C 5' 3¹ A B Indicate True (T) or False (F) for the following statements. Only use the letter (T/F)…

A: Transcription is the process by which mRNA is synthesized from DNA. Translation is the process of…

Q: THE MOLECULAR GENETICS OF CYSTIC FIBROSIS The following is the base sequence of DNA that codes for…

A: According to our guideline we can answer only first 3 subparts of a question. So, upload rest of the…

Q: 20 ORF for gene X e for gene X above has a hypomorphic mutation (which you name Mutation #1) that is…

A: Answer.) :-The given question presents an experimental scenario involving Gene X, which has a…

Q: A certain section of the coding (sense) strand of some DNA looks like this: SATGTATATCTCCAGTTAG-3…

A: Alternation of DNA sequence or any other charge in the chromosome shape or number is considered as a…

Q: 1 4 6 7 8. 9. Transcriptional stop sequence ТАTA box ATG TAA AUG UAA Here is a diagram of a human…

A: The process of transcription catalyzed by RNA Polymerase II in eukaryotes gives rise to the pre-m…

Q: in 3 5% Shown below is a schematic diagram showing a 3000 bp region of yeast genomic DNA. (Note:…

A: DNA:  The hereditary substance in humans and almost all other animals is DNA, or deoxyribonucleic…

Q: Which of the following scenarios will cause the maternal X chromosome to condense into a Barr body?…

A: The following scenarios will cause the maternal X chromosome to condense into a barr body:. Option 2…

Q: Please consider the figure below, parts A and B. A В 部 蹈器 Gene B Gene C Gene B Normal Gene A…

A: According to the question, two diagrams are given and few questions are asked. We have to solve the…

Q: Q1. (Shown below is the structure of a Drosophila gene, divided into 10 segments, designated A-J.…

A: The two steps of gene expression are transcription and translation. After transcription, the primary…

Q: What effect does histone acetylation have on Gene 1?

A: Histone  acetylation is an epigenetic modification of transcription .   Histone acetylation is the…

Q: a. As a result of the structure of DNA and RNA, replication, transcription and translation are…

A: Since you have posted a question with multiple sub-parts, we will solve the first three subparts for…

Q: 5' 3' ORF for gene X +1 ou find a mutation elsewhere in the genome (not within the sequence above)…

A: The genetic information encoded in DNA is transformed into a complementary RNA molecule during the…

Q: Genes are not always active in cells. The cell has evolved to edit its chromatin state in accord…

A: Chromatin is the region placed within DNA that contains DNA and proteins like histones. Chromatin…

Q: A. Diagram a short single strand of DNA 5’ -AA-GG- 3’. Show the chemical structure of the…

A: A nucleotide is the monomer that forms the polynucleotide strand which forms either a DNA or a RNA…

Q: 4. What is the nitrogen base pair of Adenine in transcription? * Cytosine O Uracil O guanine thymine…

A: Nucleic acid is biological macromolecules that is exhibited inside the nucleus is the cell. It…

Q: V [Choose ) Topoisomerase II RNA polymerase helicase loader must accumulate enough for DNA…

A: In transcription process RNA polymerase play major role which is a holoenzyme consist of core enzyme…

Q: a. How can a single eukaryotic gene give rise to several different types of mRNA molecules?b.…

A: The process of synthesis of mRNA from DNA is called transcription. This process takes place with the…

Q: GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation,…

A: This is a nucleotide sequence of a DNA as it contains four types of nitrogenous bases Adenine,…

Q: Find a paper published in a scientific journal between January 2018 and September 2022 that…

A: 1a. Epigenetic modifications of histones in cancer Zibo Zhao1,2 and Ali Shilatifard1,2*  They used…

Q: neurodegenerative autosomal recessive disease that results in severe disability. It is caused by…

A: The ATM gene is located on chromosome 11. It helps to control cell growth and repair damaged DNA .