UCAQ UC AG UGA0 UC UCAG GUC UOPO AC Alanine Tyrosine Stop A GU Valine Y Cysteine G A Stop AG AC A G Tryptophan U Arginine Leucine Serine Lysine A UG Proline Asparagine ACU Glutamic Aspartic acid Glycine Phenyl- alanine Leucine acid Serine Histidine Methionine Isoleucine Giutamine Arginine Threonine

Q: What is the corresponding RNA sequence, if the DNA sequence reads TACACCTGG?

A: The RNA or ribonucleic acid is single stranded macromolecule that is composed of nucleotides. RNA is…

Q: I have a presentation on the discovery of the genetic code, but I don't know how to organize my…

A: Presentation should start with a brief introduction about the genetic code. It should cover the most…

Q: Using the codon given for each amino acid (Find the table yourself) write the base sequence of mRNA…

A: Transcription is a process of formation of transcript or RNA from DNA by the process of…

Q: In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Then,…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: DNAT  A  C       C  A  C        C  C  C       C  G  T         A  T  G        G  C  T      G  G  G…

A: DNA and RNA acts as a genetic matter that carry the genetic information from one generation to…

Q: CGA CUA CCA UCA ACA GUA GGA GGC CCGC AUA CUC CCC UCC ACC GUC 3 CGG GAC AAC UGC GAA CAA GGG CAC AUC…

A: The process of synthesis of proteins with the help of messenger RNA is called translation. Proteins…

Q: What MRNA sequence codes the tripeptide shown below (write code in direction of N-terminus to…

A: Peptides are present in all individuals which are living. Peptides play may functional roles in our…

Q: The set of mRNAs present within a cell changes over time.Explain.

A: The conversion of a liquid into a gas is known as boiling or vaporization. The temperature at which…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: plain the steps of translation. Include all molecules involved in the process and their role in the…

A: Every cell has a nucleus that houses genetic material, DNA.  Genes are the segments of…

Q: Define Sense codon  as they apply to the genetic code

A: Sense codons are those codons which specify amino acids at the time of protein synthesis…

Q: What would be the effect of an insertion or deletion of one of the bases in a codon?

A: Mutation may be defined as change in single or multiple base pairs resulting in altered phenotype.…

Q: Describe the steps (Initiation, Elongation and Termination) involved in translation of mRNA to…

A: All the living cells are made up of protein, which acts as building blocks for every organism. These…

Q: A DNA codon has the sequence GAT. What is the resulting tRNA anti-codon in the translation process…

A: Codon  is a sequence of three  nucleotides present in DNA or mRNA (messenger RNA) molecule that…

Q: If there are 64 possible codons in the genetic code and the amino acid is specified by each, as read…

A: Protein synthesis is described as the process that ultimately results in the formation of proteins.…

Q: Place sequences a, b and c into the correct order based on start and stop codons. Sequence A…

A: Introduction  Codons are units of genomic information made up of three nucleotides (trinucleotides)…

Q: The amino acids listed above that are coded by the mRNA codon

A: Protein synthesis is a major process inside our body .Our body has complex system for protein…

Q: Part of being a detective is being able to decode secret messages left behind by certain…

A: The given DNA sequence is: 5'- TATGCTAGGCATTGTCGTAGGCATACG -3' 3'- ATACGATCCGTAACAGCATCCGTATGC -5'

Q: Using the genetic code, translate your mRNA sequence of 60 nucleotides into a polypeptide. Use…

A: The genetic material of the cell contains various genes that code for various proteins. This happens…

Q: DNA mutations can affect the reading frame for the genetic code. What is a human condition caused by…

A: The cell is the basic structural and functional unit of the body. The nucleus is called the brain of…

Q: Consider the following wild-type double-stranded DNA sequence: 5' TATGAA AGT3 non-transcribed strand…

A: A gene mutation that results from the substitution of one base pair of another. TATGAAAGT non…

Q: Identify if the statement is correct or incorrect, "rRNA serves as template for the synthesis of…

A: During translation, protein is formed. A segment of DNA carries the code required for specific…

Q: DNA mutations can affect the reading frame for the genetic code. What is a human condition caused by…

A: Mutations are the changes in the genome resulting in synthesis of different products. These changes…

Q: Hello , please help me with this question. I am struggling with naming the Amino Acid sequence from…

A: Codon is the triplet of either DNA or RNA nucleotides which codes for a specific amino acid during…

Q: Choose a pentapeptied composed of five different amino acids.  List the five amino acids.…

A: mRNA strand is synthesized from the template strand of the DNA by transcription. This mRNA is…

Q: Briefly describe (two or three sentences) the role of tRNA in building a protein from mRNA.

A: Answer

Q: DNA: TACGGGCCTATACGCTACTAC T CATGGATC Corresponding MRNA sequence: Corresponding amino acid sequence…

A: DNA consists of two strands which wind around each other, backbone of the DNA is formed by the…

Q: Explain in one statement/phrase why the base sequence ATC could not be a codon.

A: As per the central dogma of molecular biology, genetic information flows from DNA →RNA →Protein.…

Q: TAG, TA, and TGA are stop codor

A: 4) The 5' cap is added to the first nucleotide in the transcript during transcription. The cap is a…

Q: Write a mRNA sequence for the below nucleotide sequences ATTACACACAGCGCGTATACGCGCGCGGGCTATA

A: The mRNA sequence is considered the template strand used to form the chain of amino acids. A codon…

Q: Transcribe the following DNA molecule into mRNA.  Make sure to find the start codon to begin your…

A: A start codon initiates the transcription while stop codon terminates the transcription process.

Q: 1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG mRNA: Codon: Anticodon: Amino Acids: 2. DNA:…

A: During the process of transcription, one strand of the DNA act as the template for the synthesis of…

Q: Complete the complementary strand: mRNA transcription ATTCGAGGCTAA

A: The ribonucleic acid (RNA) molecule involves the transfer of the genetic information from the…

Q: Provide the DNA sequence (not RNA sequence) for the Start Codon and 3 Stop Codons.

A: The genetic code is a set of rules that living cells use to convert information found in genetic…

Q: Examine Table 15-2. What do the following codons specify:a. UAAb. UGAc. UAGWhat happens when a…

A: Step 1 Genetic codes are genetic information present in the nucleotide sequences of DNA…

Q: Using the genetic code, interpret the following set of nucleotides.…

A: The genetic code is a set of rules that living cells use to convert information found in genetic…

Q: What is unusual about the answers for Questions 13k, 13l, 13m, and 13n? Because the multiple codons…

A: Triplets of nucleotides are called codons which specifies individual amino aids in a polypeptide.…

Q: If one codon codes for two nucleotide than how many possible codons are there?

A: To find: How many codons are possible if one codon codes for two nucleotides