The codon chart is shown below, what amino acid sequence does the mRNA sequence: 3¹ UUUCCUCAA 5' code for? Alanine Valine 3' Arginine Serine acid Glutamic Aspartic acid U G Lysine A G C 4020402040SOTS U اد C Asparagine A RNA Codon Chart 3% Threonine AGUCAG A с leucine-threonine-glutamic acid O phenylalanine-proline-glutamine asparagine-serine-phenylalanine O serine-histidine-glutamine O phenylalanine-proline-histidine Methionine G GU A Phenyl- alanine Isoleucine in UCAGUCPG|UO|PO| U G GACUGACU GACU GADUOTOG U C Arginine Serine A Glutamine U Tyrosine Histidine Stop Cysteine Stop GTryptophan Leucine Proline 3'

Q: Using the codon given for each amino acid (Find the table yourself) write the base sequence of mRNA…

A: Transcription is a process of formation of transcript or RNA from DNA by the process of…

Q: A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:…

A: The Central dogma defines how DNA codes for proteins, which occur in three stages: replication,…

Q: What amino acid sequence is encoded by the codon sequence ACGCAGCGCCCGGUC? Use the 3 letter…

A: The amino acids are produced by the help of ribosome in the process of translation. In this process…

Q: Consider the following 2 codons sequences. Codon sequence 1:  ACU AGA GAU GUC UGC Codon sequence…

A: β-sheets are formed by adjacent parallel or antiparallel peptide strands that are hydrogen bonded in…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: Translate the following RNA sequence by using the genetic below. Start at the beginning of the…

A: The proteins are the final end product of a gene that ultimately determine the characteristics of an…

Q: de, translate the mRNA into an amino acid sequence.

A: Translation: It is the process by which sequence mRNA get translated into the sequence of amino acid…

Q: Explain why the statement is correct. A section of the mRNA has a nucleotide sequence of…

A: mRNA  A single stranded RNA which is copied from DNA and contains gene or information about specific…

Q: What is the tRNA strand for the following mRNA strand: CAGGAUGAAUUGCUC

A: To determine the tRNA (transfer RNA) sequence corresponding to the given mRNA (messenger RNA)…

Q: If the DNA sequence is 3’ ATCGACGTC 5’, what is the mRNA sequence

A: DNA is the double helix structure. Two complementary strands present in the DNA. The direction of…

Q: How many open reading frames are present in the following mRNA sequence? You may find the codon…

A: An open reading frame in molecular genetics describes the part of your reading frame that has the…

Q: You are given the following mRNA sequence. You know that it contains some UTR sequence and the…

A: The mRNA Molecule as transcribed from DNA has some untranslated regions (UTRs) at both ends. That…

Q: Provide the DNA sequencce  (not RNA sequence) for the Start Codon and 3 Stop Codons.

A: The method of determining the nucleic acid sequence – the order of nucleotides in DNA – is known as…

Q: What polypeptides would be formed from the sequence UCAATGGGGUUUAUAGCG… (there are bases after the…

A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…

Q: Translate each changed sequence. Does the mutation result in a change in the amino acid sequence? If…

A: The genetic codon present in the mRNA will be translated into polypeptide chain by ribosome during…

Q: Write the amino acid for the codons below 5'-AUG UUC CAG CUA GAU GAU AUG CUG GUA AUU GGG GAA CGC…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: 9) In another mutation from the original wild-type sequence, the bolded G in the middle of the…

A: The DNA is transformed into proteins through the process of transcription and translation.  The…

Q: For this RNA code, what is the final codon ? UACACGCCAGAGGUCGCCUUUACA

A: Introduction :- a DNA or RNA molecule that codes for a particular amino acid through a group of…

Q: The piece of eukaryotic mRNA below includes the region that codes for the binding site for the…

A: Transfer RNA, or tRNA, plays a crucial role in protein synthesis. It acts as a carrier, delivering…

Q: 5' cap amino acid aminoacyl tRNA synthetase anticodon codon EF-Tu-GTP EF-Ts eukaryote Kozak…

A: Three process combined together to form a central dogma that is replication where copy of genetic…

Q: Provide the DNA sequence (not RNA sequence) for the Start Codon and 3 Stop Codons.

A: The genetic code is a set of rules that living cells use to convert information found in genetic…

Q: Examine Table 15-2. What do the following codons specify:a. UAAb. UGAc. UAGWhat happens when a…

A: Step 1 Genetic codes are genetic information present in the nucleotide sequences of DNA…

Q: Below is the sequence of an mRNA that has just been transcribed. Please translate this sequence as…

A: Let's rearrange the mRNA in the codes of three.  ACG UCC AAU GGC AGU GAU UUG AAU CCA ACG codes for…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: The tollowing mRNA transcript would result in which polypeptide sequence? 5'-ACU UUC ACU AUG UUU UUA…

A: Protein consists of amino acids linked by amide bonds or peptide bonds.