Using the example above, transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain, identifying the codons, anticodons, and amino acid sequence. Instructions: Generate the mRNA, codon, anticodon and amino acid sequence. Use 3letter symbols for the amino acids.Remember:DNA to mRNA: G-C; A-TCodon: starts with start codon (AUG), ends with stop codon (UAA.UAG,UGA)Codon to anticodon: G-C; A-UCodon to amino acid: use genetic code (use 3 letter symbols)Example:DNA:mRNA:Codons:GTACGCGTATACCGACATTCCAUGCGCAUAUGGCUGUAAGAUG-CGC-AUA-UGG-CUG-UAAAnticodons: UAC-GCG-UAU-ACC-GAC-AUUAmino Acids: METHIONINE-ARGININE-ISOLEUCINE-TRYPTOPHAN-LEUCINEUsing the example above, transcribe the following DNA strand into mRNA and translate thatstrand into a polypeptide chain, identifying the codons, anticodons, and amino acidsequence.1. DNA: ATACGAAATCGCGATCGCGGCGATTCGGmRNA:Codon:Anticodon:Amino Acids:2. DNA: TTTACGGCCATCAGGCAATACTGGmRNA:Codon:Anitcodon:Amino Acids:

During the process of transcription, one strand of the DNA act as the template for the synthesis of…

Answered: 1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG…

1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG mRNA: Codon: Anticodon: Amino Acids: 2. DNA: TTTACGGCCATCAGGCAATACTGG mRNA: Codon: Anitcodon: Amino Acids:

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

Describe how proteins are sequenced, and explain why sequence determination is important
Define and identify the words listed below: CRISPR, codon, anti-codon, transcription
6a) Transcribe the following DNA sequence into codons. TACGCGACATTACATGAATCGTTTGGAGATTAGCCCTATTTCTCTAAGAACACGACTb) Excise(cut out) codons numbered 5, 6, and 7. Leave the remaining codons. c) Now translate the sequence . d) Explain how many amino acids are now in your polypeptide? e) What would happen to your polypeptide if either of your cysteine amino acids near the start or end of thepolypeptide were translated incorrectly. f) Based on your final polypeptide can you make the original DNA strand by doing reverse translation andtranscription? g) Explain if your polypeptide similar to your template strand or the complementary strand?
Complete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and mutated FGFR3 gene (BOTTOM). Remember, when filling in mRNA, use capital letters only. When filling in amino acids, use three letters, with the first letter capitalized. If you do not use this format, your answer may be marked wrong. DNA CCG TTC GGG GAA ССС MRNA Amino Acid DNA CCG TTC GGG GAA TCC MRNA Amino Acid
Using seven numbered steps, describe the process of translation.
Explain briefly how translation is initiated from a) prokaryotic mRNA and b) eukaryotic mRNA. Include names of any relevant sequences on the mRNA, proteins involved, including ribosomal subunits.
Provide the DNA sequence (not RNA sequence) for the Start Codon and 3 Stop Codons.
Sequence 1 : TACGCTACGGTAATC Sequence 2: TACGCTACTATCGTA
Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG
From the following DNA strand: AAGCTAGGATTGCC How many codons would be present?
Transcribe the DNA strand given above to write the sequence of the mRNA strand in the 5’ to 3’ direction. Use the table and write the sequence of the resulting peptide. Is it possible for a codon to code for another amino acid? What will be the effect if a mutation changes the codon UAU to UAA? What is a reading frame? If you are given a nucleotide sequence, how would you find Open Reading Frames? DISCUSS the reason why there are leading and lagging strands in replication?
Use the DNA sequence above, list all possible splicing products