Using the example above, transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain, identifying the codons, anticodons, and amino acid sequence. Instructions: Generate the mRNA, codon, anticodon and amino acid sequence. Use 3letter symbols for the amino acids.Remember:DNA to mRNA: G-C; A-TCodon: starts with start codon (AUG), ends with stop codon (UAA.UAG,UGA)Codon to anticodon: G-C; A-UCodon to amino acid: use genetic code (use 3 letter symbols)Example:DNA:mRNA:Codons:GTACGCGTATACCGACATTCCAUGCGCAUAUGGCUGUAAGAUG-CGC-AUA-UGG-CUG-UAAAnticodons: UAC-GCG-UAU-ACC-GAC-AUUAmino Acids: METHIONINE-ARGININE-ISOLEUCINE-TRYPTOPHAN-LEUCINEUsing the example above, transcribe the following DNA strand into mRNA and translate thatstrand into a polypeptide chain, identifying the codons, anticodons, and amino acidsequence.1. DNA: ATACGAAATCGCGATCGCGGCGATTCGGmRNA:Codon:Anticodon:Amino Acids:2. DNA: TTTACGGCCATCAGGCAATACTGGmRNA:Codon:Anitcodon:Amino Acids:

During the process of transcription, one strand of the DNA act as the template for the synthesis of…

Answered: 1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG…

1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG mRNA: Codon: Anticodon: Amino Acids: 2. DNA: TTTACGGCCATCAGGCAATACTGG mRNA: Codon: Anitcodon: Amino Acids:

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Related questions

Q: if there are multiple start condo, how can you identify the real start codon? a) By observing…

A: The DNA or RNA sequence consists of three nucleotides and determines the particular amino acid that…

Q: In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Then,…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: What amino acid sequence is encoded by the codon sequence ACGCAGCGCCCGGUC? Use the 3 letter…

A: The amino acids are produced by the help of ribosome in the process of translation. In this process…

Q: Describe how protein are created in translation. Step by step

A: The translation is the process of protein synthesis.

Q: Name and describe in DETAIL the three steps of translation.

A: Polymerization of amino acids to generate a chain of polypeptides is known as translation.…

Q: Name the process by which the information on DNA is copied into an RNA molecule.

A: Nucleic acids store and transmit hereditary information. There are two types of nucleic acids:…

Q: Several different nucleic acids are involved in the process of getting a protein produced from a…

A: Sense strand is that strand of DNA double helix which has the translatable protein code in the 5'-3'…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:

A: This question is based on the functioning of mRNA expression.

Q: What is an Okazaki fragment, and how are they later “glued” together?

A: In the semi discontinuous mode of replication when DNA unwinds , one strand is synthesized…

Q: describe the process of reading a gene and turning it into a protein in a eukaryote.Your first…

A: Transcription: The process of conversion of segment of the DNA to RNA is called as Transcription.…

Q: Using a table that shows which codon represents which amino acid determine the following: A)…

A: The three nucleotide sequence either DNA or RNA is called codons.During protein synthesis, it codes…

Q: TACTGCCTCCCCATAAGAATT

A: Transcription is the process in which a gene's DNA sequence is copied (transcribed) to make an RNA…

Q: If the sequence of mRNA is 5'-AAUCGUACGGAUGCCGAAAUACCCAUUAGGGAUUGCAUAGCGAGCAACGGAC-3', what is the…

A: Protein is the final product of a gene that determine the phenotype of the organism. Protein…

Q: describe insertion sequences

A: DNA is the information centre for most organisms. DNA is made up of a long chain of nucleotide base…

Q: A) Describe each step of the DNA REPLICATION in EUKARYOTIC organisms B) Describe each step of the…

A: Transcription = Re-writing DNA into RNADNA is "transcribed" or re-written into RNA in a very…

Q: Decode the unknown word using the genetic code and fill out the missing nucleotides. Translate the…

A: The disorders of the blood influence or alter the functioning of the red blood cells, white blood…

Q: The following sequence represents a few codons present in one strand of DNA.Using this strand of DNA…

A: DNA replication is the process of formation of copies of DNA. It takes place in nucleus of cell.…

Q: Transcribe and translate the following DNA sequence (nontemplate strand);…

A: The gene is expressed into protein by the transcription and translation step.

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: The following double stranded segment of DNA is part of a protein coding gene. The segments in…

Q: Give some points about the flow of information during translation?

A: Translation is the process of protein synthesis from mRNA (Messenger ribonucleic acid) with the help…

Q: Define Sense codon as they apply to the genetic code

A: Sense codons are those codons which specify amino acids at the time of protein synthesis…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: 1a) Name the start codon and the three stop codons for translation. 1b) What amino acid is…

A: An mRNA codon is a triplet or triple-nucleotide sequence that codes for a certain amino acid during…

Q: A DNA codon has the sequence GAT. What is the resulting tRNA anti-codon in the translation process…

A: Codon is a sequence of three nucleotides present in DNA or mRNA (messenger RNA) molecule that…

Q: Using this strand of DNA (TACAACTGA), show what a deletion and insertion would look like”

A: Nucleotides are subunits of DNA, and each nucleotide is made of a sugar molecule called deoxyribose,…

Q: Illustrate the process of translation by providing the correct bases for tRNA strand given the mRNA…

A: The genetic code includes the information on DNA for the protein made from RNA, which is called gene…

Q: For translation, identify two things that happen during each step - initiation, elongation and…

A: Translation is a complex process it is the final formation of protein with the help of m RNA, t RNA…

Q: The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1)…

A: At first you have to know about coding and non-coding strand. A coding atrand is a DNA strand that…

Q: Given the following DNA sequence of the template (i.e. noncoding) strand for a given gene:…

A: The double-stranded DNA molecule is made up of two DNA strands known as the template strand and the…

Q: Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic…

A: An exon is any part of a gene that will encode a part of the final mature RNA produced by that gene…

Q: Translate this nucleotide sequence into an amino acid sequence. Gene Sequence (5'-to-3'):…

A: Translation is a biological process that converts a nucleotide sequence into an amino acid sequence.…

Q: create a summary of the nucleotide pairs during the translation process

A: Answer: Introduction: Translation process occurs in ribosomes of cytosol or membrane of the…

Q: DNA mutations can affect the reading frame for the genetic code. What is a human condition caused by…

A: Mutations are the changes in the genome resulting in synthesis of different products. These changes…

Q: 1. Using the table of the genetic code, determine the sequence of amino acids. 2. If mutation occurs…

A: Codons are triplets of nucleotides in the mRNA sequence, which is read by the ribosomes in order to…

Q: ribe the crucial role of base pairing between codon and anticodon.

A: The hereditary material translated into messenger RNA is expressed by the triplet code (mRNA). The…

Q: The following segment of mRNA encodes an interstitial segment of a polypeptide (the different codons…

A: Due to the fact that when two DNA or RNA sequences are aligned anti-parallel to one another, the…

Q: A single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a)…

A: The transcription is the process in which the mRNA copied information from DNA for protein…

Question

Using the example above, transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain, identifying the codons, anticodons, and amino acid sequence.

Instructions: Generate the mRNA, codon, anticodon and amino acid sequence. Use 3
letter symbols for the amino acids.
Remember:
DNA to mRNA: G-C; A-T
Codon: starts with start codon (AUG), ends with stop codon (UAA.UAG,UGA)
Codon to anticodon: G-C; A-U
Codon to amino acid: use genetic code (use 3 letter symbols)
Example:
DNA:
mRNA:
Codons:
GTACGCGTATACCGACATTC
CAUGCGCAUAUGGCUGUAAG
AUG-CGC-AUA-UGG-CUG-UAA
Anticodons: UAC-GCG-UAU-ACC-GAC-AUU
Amino Acids: METHIONINE-ARGININE-ISOLEUCINE-TRYPTOPHAN-LEUCINE
Using the example above, transcribe the following DNA strand into mRNA and translate that
strand into a polypeptide chain, identifying the codons, anticodons, and amino acid
sequence.
1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG
mRNA:
Codon:
Anticodon:
Amino Acids:
2. DNA: TTTACGGCCATCAGGCAATACTGG
mRNA:
Codon:
Anitcodon:
Amino Acids:

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

Describe how proteins are sequenced, and explain why sequence determination is important
Describe the steps necessary to synthesize mRNA fromeach of the following: double-stranded DNA, singlestranded (1)DNA, single-stranded (2)DNA, singlestranded (1)RNA, and single-stranded (2)RNA.
Define Termination codon as they apply to the genetic code
Define and identify the words listed below: CRISPR, codon, anti-codon, transcription
Assuming the genetic code is a triplet, what effect would the addition or loss of two nucleotides have on the reading frame? The addition or loss of three, six, or nine nucleotides?
6a) Transcribe the following DNA sequence into codons. TACGCGACATTACATGAATCGTTTGGAGATTAGCCCTATTTCTCTAAGAACACGACTb) Excise(cut out) codons numbered 5, 6, and 7. Leave the remaining codons. c) Now translate the sequence . d) Explain how many amino acids are now in your polypeptide? e) What would happen to your polypeptide if either of your cysteine amino acids near the start or end of thepolypeptide were translated incorrectly. f) Based on your final polypeptide can you make the original DNA strand by doing reverse translation andtranscription? g) Explain if your polypeptide similar to your template strand or the complementary strand?
Describe the process where a peptide chain is formen from a code embedded in a nucleic acid molecule. Name the process, which mavromolecule plays a central role and which nucleic acid molecule is involved? What is the codon and how is the codon involved? How is it ensured that correct amino acid and in the correct order are bonded together?
Complete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and mutated FGFR3 gene (BOTTOM). Remember, when filling in mRNA, use capital letters only. When filling in amino acids, use three letters, with the first letter capitalized. If you do not use this format, your answer may be marked wrong. DNA CCG TTC GGG GAA ССС MRNA Amino Acid DNA CCG TTC GGG GAA TCC MRNA Amino Acid
Using seven numbered steps, describe the process of translation.
Explain briefly how translation is initiated from a) prokaryotic mRNA and b) eukaryotic mRNA. Include names of any relevant sequences on the mRNA, proteins involved, including ribosomal subunits.
Provide the DNA sequence (not RNA sequence) for the Start Codon and 3 Stop Codons.
A template DNA strand coded for the following sequence: CTCAAGTTATGTATGTCCGATTCGCATGCGCT 1) What is the sequence of the complementary mRNA strand? 3 po 2) What is the sequence of the coding DNA strand? 3) After translation was complete, the resulting polypeptide underwent post-translational modification wherein the N-terminal Met residue was removed from the polypeptide. Using one-letter abbreviations, write out the resulting amino acid sequence of the polypeptide after post-translational modification.