1. You are given the following DNA sequence andyou want to know what protein it codes for.DNA: TACGGGCCTATACGCTACTACT CATGGATCCorresponding mRNA sequence:Corresponding amino acid sequence (use thechart from before):2. You are given the following DNA sequence andyou want to know what protein it codes for.DNA: GTACGCGTATACCGACATCorresponding mRNA sequence:Corresponding amino acid sequence (use thechart from before): Codon chart: We interpret mRNA 3 base pairs at a time.This is known as a codon. A codon table can be used totranslate a genetic code into an amino acid sequence.The full set of relationships between codons and aminoacids (or stop signals) is called the genetic code. Thegenetic code is often summarized in a table like the onebelow.Second letterAGUUUUUC JUGU CysUCU)UCCUCAUCGJUAUUPheTyrUACSUGCJSerUAA Stop UGA Stop AUAG Stop UGG TrpUUAUUG FLeuGCUU )CỤCCUACUGCCU )СССССАCCGCGUCGCArgCAU)CÁC HisСААLeuProCGAGinCAGCGGAUUAAUACUАСCACAAsnAGUSerAAC JAsh AGC.AUC leAAUAAGA ArgThrAAAAAG.}LysAAUG Met ACGAGG JGGUUGUCGValGUAGUGGCU)GCCGCAGCGGAU1GACSGAA)GAG GluGGUGGCGlyUCAAlaGGAGGG]GFirst letterUUAGThird letter

Name: 1. You are given the following DNA sequence andyou want to know what
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 1. You are given the following DNA sequence andyou want to know what protein it codes for.DNA: TACGGGCCTATACGCTACTACT CATGGATCCorresponding mRNA sequence:Corresponding amino acid sequence (use thechart from before):2. You are given the following DNA