Use this mRNA coding sequence as your starting point. This sequence begins with a start codon and ends with a stop codon, so it is only looking at the region of DNA that directly encodes a protein sequence. 5’-AUGCACAAAUUAGAGUACCCCCCAGGAAGGUAG-3’ Make the following mutation in this sequence by changing/adding/removing only one nucleotide. Make the mutation easy to see (a different color, circled, something like that) 1) A silent mutation that is also a transition
Q: Describe the Calvin cycle and the products of the Calvin cycle
A: The process whereby light energy is transformed into chemical energy in the form of sugars is known…
Q: Arrange the following structures and vessels in the correct order in which lymph would flow from a…
A: Lymph is the excess tissue fluid that is collected by the lymphatic vessels. Lymph and lymphatic…
Q: 1. Researchers at the University of Adelaide, Australia, are proposing to control cyanobacteria with…
A: A microorganism is an organism which cannot be seen with the naked eyes, they can be seen using a…
Q: When blood first enters a capillary it tends to __ material; when the blood is leaving a capillary…
A: Option (B):- Lose; gain Explanation- The wall of capillary is very thin and single layered.…
Q: A common way to deliver anesthesia for surgery and childbirth is to inject the anesthetic agent into…
A: Surgery, some screening and diagnostic tests, tissue sample removal, and dental treatments are just…
Q: How a molecule of hemoglobin is able to bind oxygen efficiently in the lungs and yet release it…
A: The red blood cells of higher animals include the protein haemoglobin, which carries oxygen. A…
Q: type of mutations would be the worst types
A: Mutation: It is defined as the change in the DNA base pair sequence due to the environmental…
Q: are there a children's stories, songs or poems which include the taxon Trematoda? If so what are…
A: Introduction Trematoda is flatworms is a class within the phylum Platyhelminthes, class Trematoda,…
Q: answer the given question below. multiple answer is possible and if non of the answer is you think…
A: The cells created during cleavage start to move in relation to one another during gastrulation. As…
Q: O A B C D LL Which statement is true regarding the tree above? O A. A is more closely related to B…
A: Introduction : A phylogenetic tree is a visual representation of the evolutionary connections…
Q: Answer the following questions, with the assumption that Spongebob Squarepants is indeed a member of…
A: Spongebob is a comic character and is said to possess the poriferan characters. The main poriferan…
Q: 5. dently methods of cancer treatment and prevention You can prevent cancer by not smoking, eating a…
A: Uncontrolled cell division gives rise to a lump of cells which will eventually develop into cancer.…
Q: benign prostatic hyperplasia
A: Benign prostatic hyperplasia, a noncancerous enlargement of the prostate gland, is the most common…
Q: 5. What effect can priming MSCs with IFN-gamma have on Type 1 and 2 helper T cells?
A: Mesenchymal stem cells (MSCs) These are stromal cells with multilineage differentiation and the…
Q: Question 1 a. What is the difference between incomplete metamorphosis and gradual metamorphosis? b.…
A: Metamorphosis can be defined as the process in which transformation or development of an animal…
Q: Give more detail answer Please. Thank You Your current LIS system will no longer be supported by…
A: Introduction:- To understand the need and the requirement of the data and the different types of…
Q: Sexual reproduction favors_______________ genetic variation highly successful species stable…
A: Introduction :- The process of creating new organisms through the fusion of the genetic material of…
Q: Explain the reason why transposable elements are rare in the Hox clusters.
A: The arrangement of the Hox genes on chromosome 2 corresponds to the sequence in which they are…
Q: Describe the process of oxidative phosphorylation and ETC in bacterial cells. Include the roles and…
A: Introduction An electron transport chain is made up of a number of protein complexes and other…
Q: Phosphorylation is a very common post-translational modication (PTM) to regulate protein function.…
A: Introduction Phosphorylation is a biochemical process. It involves the addition of phosphate to an…
Q: A somatic cell is a cell specialized for maintenance an growth in an organism. Group of answer…
A: INTRODUCTION Somatic cell Any cell in the body other than germ cells and stem cell.
Q: escribe the role of DNA methylation in gene expression in mammalian cells.
A: Modification of DNA occurs by the addition of methyl group to the cytosine of the nucleotide…
Q: 1. Construct a map of a chromosome containing 4 genes. Some of the distances between these genes are…
A: Linkage is a phenomenon which evaluates how genes are placed on close proximity to each other on…
Q: Without enzymes , reactants would never from products False or true ?
A: Introduction Protein catalysts called enzymes are essential for numerous bodily activities. Enzymes…
Q: Match the muscles to the movements which are caused when the respective muscles contract…
A: Joints are moved for the locomotion of the body. The various movements involve flexion, extension,…
Q: John frequently encountered bacterial infections. Tests for immune cells showed the presence of…
A: Complement cascade is the part of innate immunity that consists of lot of proteins acting in a…
Q: Hybrid incompatibility resulting from negative epistasis is know as __________ and is a…
A: Hybrid incompatibility is also known as Hybrid sterility .It is the phenomenon in which hybrids…
Q: 3. An individual heterozygous for the following three alleles (XYZ) was testcrossed to a homozygous…
A: Given, XYZ = 200 xyz = 210 xYZ = 215 Xyz = 205 xYz = 80 XyZ =90 xyZ = 85 XYz = 95 Therefore, total…
Q: 10) Why do aerobic cells need oxygen? Where exactly is the oxygen needed?
A: Respiration is the process of energy generation. The complex macromolecules ingested in the food are…
Q: what are the examples of regulators for each of the levels (A, B, and C)
A: Regulatory proteins are small molecules including enzymes and various factors that regulate the…
Q: pH using universal indicator A1. After letting the urine stand for 1 hour, what changes…
A: Urine formed by the nephrons of Kidneys. It is formed by three processes, these are glomerular…
Q: What mechanism of action does Ciprofloxacin belong in? 1.inhibition of cell wall synthesis…
A: 2. Inhibition of nucleic acid synthesis.
Q: Examine whether the statement "in terms of the way it interacts with DNA, the helix-loop-helix motif…
A: A structural motif that may identify a particular DNA sequence makes up a DNA-binding domain.…
Q: 1. Discuss some advantages and disadvantages of fertilizer. 2. Why does eating meat carry more…
A: Introduction An organism that has had its DNA altered through the use of genetic engineering…
Q: MODIFIED TRUE OR FALSE. In the following items, read each statement carefully. I. About 20 L of…
A: Innate immunity is the body's defence mechanism that is present at birth. Adaptive immunity is the…
Q: 9. What strategy has been used to reduce bone resorption following hip or joint replacement? How…
A: Bone resorption is the decreased bone density in patients. Diseases are characterized by an…
Q: Examine whether the statement "Gene duplication and divergence is thought to have played a critical…
A: Gene duplication is caused by the duplication or amplification of a gene sequence. DNA damage,…
Q: 1. What is the overall charge of alkaline phosphatase? a. Which type is used to purify APase?…
A: Alkaline phosphatase Alkaline phosphatase is an enzyme that plays a role in dephosphorylation of…
Q: Food Eggs Red meat (pounds) Whole milk (gallons) Cheese (pounds) Fruits (pounds) Grains (pounds) How…
A: The answer is option c. The more people becoming vegetarians. The vegetarians food such as grains,…
Q: summarize what Miescher learned from these experiments about the contents of the cell nucleus and…
A: Introduction: The hereditary ingredient in a cell is genetic material. It contains all of an…
Q: larvae that affects crops?
A: The life cycle of insect goes through 4 different stages .These 4 stages of the life cycle are eggs…
Q: Is the solute potential of the cell increased or decreased by plasmolysis? Explain.
A: plasmolysis is a process in which the cells reduce water in presence of hypertonic solution. this…
Q: According to the passage, what is the probable effect of growing insectivorous plants in richer…
A: D PLANTS GROW TO MUCH LARGER SIZE. Plant takes nutrient from richer soil and grow in size.
Q: Provide the term used for the type of transmission filth flies are capable of, and briefly describe…
A: Filth flies These flies breed in garbage, food waste, and animal dung. House flies and bottle flies…
Q: G cells Mucous neck cells Parietal cells Hepatocytes Pacemaker cells Type A cell Granular cells…
A: Cells are the basic units of life. All living things are made up of cells. Cells are very small;…
Q: Bacteria between the gums and tooth that causes inflammation there is called: 1)dental caries 2)root…
A: Answer and explanation - Gingivitis-Gingivitis is mild gum disease. It is an infection caused by…
Q: What are the differences between impeller design for microbial, mammalian, and plant bioreactor and…
A: In bio-process technology, impeller is an agitating device which is employed to stir the…
Q: What produces the main driving force which drives quiet expiration? A. contraction of the…
A: C. Elasticity of the diaphragm muscle.
Q: Why is amphioxus important in the story of evolution? What does its anatomy shed light on?
A: The amphioxus is found to be important by the scientists in the story of evolution because the…
Q: Review the descriptions from the Baltimore system of virus classification. Group II Group III Group…
A: The Baltimore system of virus classification is a system of classifying viruses based on their…
Use this mRNA coding sequence as your starting point. This sequence begins with a start codon and ends with a stop codon, so it is only looking at the region of DNA that directly encodes a protein sequence.
5’-AUGCACAAAUUAGAGUACCCCCCAGGAAGGUAG-3’
Make the following mutation in this sequence by changing/adding/removing only one
1) A silent mutation that is also a transition
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- mRNA Codon Chart: Second letter с บบบ UCU UAU Phe UUC UCC U Ser UAC Tyr UGU UGC Cys UUA UCA Leu UAA Stop UGA Stop A UUG UCG UAG Stop UGG Trp CUU CCU CAU CGU CUC CCC His CAC Leu Pro CUA CCA CAA CGA Arg Gin CUG CCG CAG CGG AUU ACU AAU AUC lle ACC AAC AGU ]Asn Ser AGC A Thr AUA ACA AAA Lys AGA Arg AUG Met ACG AGG GUU GCU GAU GUC GCC Val GAC Asp GGU GGC Ala GUA GCA GUG GCG GAG GGG GAA Glu GGA Gly Amino Acid 3-Letter Codes Name of Amino Name of Amino 3-Letter Code 3-Letter Code Acid Acid Alanine Ala Leucine Leu Arginine Arg Lysine Lys Asparagine sex Methionine Met (start) Aspartic Acid Asp Phenylalanine ebe Cysteine Cve Proline Pro Glutamic Acid Glu Serine Ser Glutamine Gln Threonine Glycine GLK Tryptophan JAR Histidine His Tyrosine Tyr Isoleucine lle Valine Val Exercise: Transcription & Translation 1. Choose 3 DNA Templates. 2. Write the mRNA sequence divided into 3 letter codons. 3. Write the sequence of amino acids. 4. Find the corresponding amino acid sequence and include the letter of…5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above sequence? Please use the one-letter code for your answers. (You will need to consult the Table of the Genetic Code for this question) 1st letter UUU Phe UCU UCC Leu UCA UCG U UUC UUA UUG CUU C CUC CUA CUG AUU A AUC AUA AUG U GUU G GUC GUA GUG CCU Leu CCC CCA CCG ACU lle ACC ACA Met ACG GCU Val GCC GCA GCG с Second Letter Ser Pro Thr Ala UAU UAC A | AAU AAC AAA AAG GAU GAC GAA GAG Tyr CAU CAC CAA Gin CAG 1 UAA Stop UGA Stop A UAG Stop UGG Trp G His Lys UGU UGC Asp Glu G 3rd Asn AGU Ser U letter AGC AGA AGG Cys U CGU CGC Arg CGA CGG GGU GGC GGA GGG DCAG DUAG DUCAG Arg Gly UCAG5'-TAGCTGATCGAATATGCGGTCTCTATCTTCGTAGACGA-3' 3'-ATCGACTAGCTTATACGCCAGAGATAGAAGCATCTGCT -5' Determine the amino acids that will be encoded by this sequence Second letter First letter U C A G U UUU Phe UUC UUA UUG Leu CUU CUC CUA CUG Leu GUU GUC GUA GUG Val UCU UCC UCA UCGJ AUU AUC lle AUA ACA AUG Met ACG CCU CCC C CCA CCG ACU ACC GCU GCC GCA GCG Ser - Pro Thr Ala A UGU UACTyr Cys UGC. UAA Stop UGA Stop A UAG Stop UGG Trp G CAC His CAA Gin CAG GAUT GAC Asp GAA AAU Asn ACC Ser AGU AAG LYS AA Glu GAGJ Oa. N-Met-Arg - Ser-Leu-Ser - Ser-C Ob. N-Met-Pro-Arg - Asn-Asp - Ser-C d. N-Met-Lys - Val-Glu-Ala-C Oc. N-Asp-Pro-Lys - Ser - Val-Ile-C Oe. N- Met-Ala-Asp-Pro-Lys - Ser-C G CGU CGC CGA CGG AGA AGG. GGU GGC GGA GGG Arg SCAO Gly U UCAG UUA DUAG Arg G Third letter 13
- Second letter C A UUU Phenyl- UUC alanine UCU UCC UAU UAC UGU UGC Tyrosine Cysteine Serine UCA UCG UAA Stop codon UAG Stop codon UGA Stop codon UGG Tryptophan UUA A Leucine UUG CCU ССС CAU CAC CUU CGU CGC Histidine C CUC C CUA Leucine Proline Arginine CCA СCG CGA CGG A CAA CAG CUG Glutamine AGU AGC AUU AAU ААС ACU Asparagine Serine AUC Isoleucine A AUA ACC АСА Threonine AAA AGA Methionine; start codon ACG Lysine Arginine AUG AAG AGG U GUU GUC GUA GCU GCC GCA GAU Aspartic GAC acid GGU GGC GGA GGG Valine Alanine Glycine GAA Glutamic GAG acid GUG GCG G Given the codon UCA in the first exon of a gene, which change is most likely to result in a nonsense mutation? A transversion of A to U Change of nucleotide in the third position Change of nucleotide in the first position A transition of A to G Change of nucleotide in the second position First letter Third letterUsing the Genetic Code Table in Figure 1.3, what is the proper sequence of amino acids in the polypeptide chain based from the given codons of MRNA (3' AAU GCC AGU GGU 5')? * U UUU Phe UCU) UC UCA UCG UAU] UAC Tyr UAA Stop UGA Stop A UAG Stop UGG Trp G UGU U UUC) UGC Cys Ser UUA Leu UUGJ CU) CCU CAU1 CGU His CUC CAC CAA CGC CC Leu CCA Pro Arg CUA CGA A Gin CUG) CG CAG CGG G AUU) ACU) AGU AAU1 Asn AAC, Thr AAA1 U AGC }Ser č A G AUC lle ACC A AUA J ACA AGA AUG Met ACG, AAG}Lys AGG Arg GGU GUU) GUC Val GCU) GCC GCA GCG J GAU1 Asp GACI Ala GGC GGA GGG ) G GUA Gly GAA1 GAG) A Glu GUG) G Figure 1.3 Alanine, Serine, Glycine, Asparagine Serine, Glycine, Asparagine, Alanine Glycine, Asparagine, Alanine, Serine Asparagine, Alanine, Serine, Glycine5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3′ What oligopeptide is encoded by the above sequence? Please use the one-letter code for your answers. (You will need to consult the Table of the Genetic Code for this question) 1st letter UUU Phe UCU U UUC UUA UUG CUU C CUC CUA CUG U Leu GUA GUG CCU Leu CCC CCA CCG AUU ACU A AUC ACC AUA ACA AUG Met ACG lle UCC Ser UCA UCG GUU GCU G GUC Val GCC с GCA GCG Second Letter Pro Thr Ala A | Tyr UAU UAC UAA Stop UAG Stop CAU His CAC CAA Gin CAG AAU Asn AAC AAA AAG GAU GAC GAA GAG UGU Cys U UGC UGA Stop A UGG Trp G AGU AGC AGA Lys AGG | Asp Glu CGU CGC Arg CGA CGG Arg UCAG ULAG SCAG GGU GGC Gly GGA GGG с Ser U letter 3rd G
- MRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Code-End of the Amino Acid MRNA Codons* (anticodon) tRNA Alanine GCU AGA Arginine Asparagine Aspartic Acid Cysteine Glutamic Acid Glutamine Glycine Histidine AAU GAU UGU GAA CAA GGU CAU AUU CUU AAA AUG Isoleucine Leucine Lysine Methionine UUU Phenylalanine Proline CCU UCU Serine ACU UGG Threonine Tryptophan Tyrosine Valine UAU GUA There are 64 codons. Some amino acids have several mRNA codor There is, however, no overlap of codes.Given the genetic code below, enter the correct amino acid sequence for the following RNA sequence: AUG GAG UCC UUG CUG UGA (enter the amino acids as the 3 letter abbreviation on the table separated by dashes with no spaces e.g. Met-Thr-Lys-Glu-Ser) Alanine (Ala) AGUC Tyrosine (Tyr) Valine (Val) GU Cysteine (Cys) START HERE G Arginine (Arg) G Tryptophan (Trp) A C CUGA Serine (Ser) Leucine (Leu) Lysine (Lys) Proline (Pro) Asparagine (Asn) 0406 ACUGACUOROE (na) auone (aug) Giycine (Gly) Serine (Ser) Phenylalanine Glutamic acid (Glu) Aspartic acid (Asp) Histidine (His) Glutamine (Gin) Arginine (Arg) Isoleucine (lle) Methionine (Met) o Threonine (Thr)MRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Amino Acid Code-End of the MRNA Codons* (anticodon) tRNA Alanine GCU Arginine Asparagine Aspartic Acid Cysteine Glutamic Acid AGA AAU GAU UGU GAA Glutamine CAA Glycine Histidine GGU CAU Isoleucine AUU Leucine CUU Lysine Methionine AAA AUG Phenylalanine Proline UUU CCU Serine UCU Threonine ACU Tryptophan Tyrosine Valine UGG UAU GUA * There are 64 codons. Some amino acids have several mRNA codons. There is, however, no overlap of codes. 1. You should be able to fill in the 3-letter "code-end" of the tRNA molecules in the table above. Remember, in RNA A pairs with U, and G pairs with C. There is no thymine. Fill in the table.
- Table 8.2 Codons in mRNA molecule and their corresponding amino acids UUU UUA GCA AAG GOU O nonsense Oleucine Refer to Table 8.2. UAU codes for which amino acid? O lysine O alanine Phenylalanine UAU leucine UAA alanine lysine valine UCG, UCU O tyrosine AAU UGC tyrosine nonsense asparagine cysteine serinemRNA sequence of A gene If we have the following mutations, find the type of the mutation (silent or missense or nonsense?) 17CàU 36GàA 49GàU 115AàC 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCC UACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACG ACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGC UGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGA GGUAGAAGCCGCUGGGGCUUGGGGCU-3’Refer to the information on the genetic code. Use this information to determine how many amino acids are coded for by the mRNA sequence AUGCGCAGUCGGUAG. The genetic code Second letter of codon UAU UAC JUU Phenylalanine uCU UUC Phe) UUA Leucine (Leu) UUG Tyrosine (Tyr) GCysteine (Cys) UGC 1oStop codon |UGG Tryptophan (Trp) CGU CGC UcC Serine (Ser) UCA ucc CCU cC Proline (Pro) Stop codon UAG Stop codon CAU Histidine His) CU CUC CUA CUG Arginine (Arg) Leucine (Leu) cca CAA CCA CGA Glutamine (Gin) CAG AUU AUC AUA ACU Isoleucine (le) AAU AAC AGU AGC Asparagine (Asn) Serine (Ser) ACC Threonine (Thr) ACA Methicnine ACC start codon GCU Lysine (Lys) AGA Arginine (Arg) ARC AGS GAU Aspartic acid (Asp)G0 GAC GUU GUC Valine (Val) GCC Alanine (Ab) GG Glycine (Gly GUA GUG GCA GCG GA Glutamic acid (Glu) GA GGG GAG 4 15 First letter of codon Third letter of codon