Please answer all parts of this question A. Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is the non-underlined sequence between the exons. TAG, TAA, and TGA are stop codons.5-ТAGTGTATTGACATGATAGAAGCACTCACTАТАТТСTGACGTGCGACTАTGCGTGGGGTTAGGTАТTGTGCTGAСТTTTСТCAGGTGGCCCGTATAGGСТААGСTGCGСАТCGCCGCTAGTCGCTCAGTTCССCTGGCGGCATTTТААСТТТСТTTААTGAATGCGGGCATATTTAATACGCGCTATGCGCАТCGTATGCGAТ-3'1) What are the first five deoxyribonucleotides of the DNA template strand read by RNA polymerase in the 3' to 5' direction?3'--5'2) What are the first five ribonucleotides of the MRNA transcript of this gene ?5'--3'3) What are the first five ribonucleotides following exon 1 in the mature MRNA transcript?5'--3'4) What is the 5' UTR of the mature MRNA transcript in ribonucleotides?5'--3'5A) What are the first five ribonucleotides of the 3' UTR?5'--3'B) What are the last five ribonucleotides of the 3' UTR?5'--3'6) How many amino acids are in the protein encoded by the MRNA?amino acids7) Using a codon chart, translate the mRNA transcript into protein, using the single letter amino acid code and no spaces.N terminus--C terminus8) The bolded "A" nucleotide near the beginning of line 2 is the adenine in the intron that is responsible for forming the lariat during splicing. It is thus part of the consensus splicing motif.A) If this is mutated to G, what are the 5 ribonucleotides following exon 1 in the mature MRNA transcript?5'--3'B) Does this mutation result in a frame shift?C) How many amino acids are in the protein encoded by the MRNA following this mutation?amino acidsD) Using a codon chart (posted under the Translation module in Moodle), translate the MRNA transcript with the mutation described in 8A into protein, using the single letter amino acid code and no spaces.N terminus--C terminus9) In another mutation from the original wild-type sequence, the bolded G in the middle of the second line is mutated to A.A)How many amino acids are in the protein encoded by the mRNA?amino acidsB) Using a codon chart, translate the mRNA transcript with the mutation described in 9 into protein, using the single letter amino acid code and no spaces.N terminus--C terminus

Answered: A. Below is a small 2 exon long gene.…

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Related questions

Question

Please answer all parts of this question

A. Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is the non-underlined sequence between the exons. TAG, TAA, and TGA are stop codons.
5-ТAGTGTATTGACATGATAGAAGCACTCACTАТАТТСTGACGTGCGACTАTGCGTGGGGTTAGGT
АТTGTGCTGAСТTTTСТCAGGTGGCCCGTATAGGСТААGСTGCGСАТCGCCGCTAGTCGCTCAGTTCССC
TGGCGGCATTTТААСТТТСТTTААTGAATGCGGGCATATTTAATACGCGCTATGCGCАТCGTATGCGAТ-3'
1) What are the first five deoxyribonucleotides of the DNA template strand read by RNA polymerase in the 3' to 5' direction?
3'-
-5'
2) What are the first five ribonucleotides of the MRNA transcript of this gene ?
5'-
-3'
3) What are the first five ribonucleotides following exon 1 in the mature MRNA transcript?
5'-
-3'
4) What is the 5' UTR of the mature MRNA transcript in ribonucleotides?
5'-
-3'
5A) What are the first five ribonucleotides of the 3' UTR?
5'-
-3'
B) What are the last five ribonucleotides of the 3' UTR?
5'-
-3'
6) How many amino acids are in the protein encoded by the MRNA?
amino acids
7) Using a codon chart, translate the mRNA transcript into protein, using the single letter amino acid code and no spaces.
N terminus-
-C terminus
8) The bolded "A" nucleotide near the beginning of line 2 is the adenine in the intron that is responsible for forming the lariat during splicing. It is thus part of the consensus splicing motif.
A) If this is mutated to G, what are the 5 ribonucleotides following exon 1 in the mature MRNA transcript?
5'-
-3'
B) Does this mutation result in a frame shift?
C) How many amino acids are in the protein encoded by the MRNA following this mutation?
amino acids
D) Using a codon chart (posted under the Translation module in Moodle), translate the MRNA transcript with the mutation described in 8A into protein, using the single letter amino acid code and no spaces.
N terminus-
-C terminus
9) In another mutation from the original wild-type sequence, the bolded G in the middle of the second line is mutated to A.
A)How many amino acids are in the protein encoded by the mRNA?
amino acids
B) Using a codon chart, translate the mRNA transcript with the mutation described in 9 into protein, using the single letter amino acid code and no spaces.
N terminus-
-C terminus

Expert Solution

Step 1

"Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts for you. To get the remaining sub-part to be solved please repost the complete question and mention the sub-parts to be solved"

The part of a gene that codes for amino acids is called an exon. Most gene sequences in plants and animals' cells are broken up by one or more DNA sequences known as introns. Exons are parts of the gene sequence that are expressed in the protein, whereas introns are regions of the gene sequence that are not expressed in the protein and come between or interfere with the exons. Now, when RNA is first transcribed, it is a very, very long RNA molecule. The exons are the most crucial sections of the RNA. There are huge portions of RNA that get cut out.

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions