Translate the following DNA sequence into a sequence of amino acids: TAC TAA GGA. The genetic code

Q: A Section of a Gene CTA AAA TAG TCT For the DNA sequence shown above, identify the following: mRNA…

A: A biological process in which the information present in DNA is copied to RNA (mRNA) is known as…

Q: The genetic code: UUC, UCU, CUU a phe, ser, leu. UUA, UAC, ACU, CUU A leu, thr, tyr UCU, CUC a ser,…

A: Need to say why the genetic code are correct.  It is converted from mRNA to amino acid.

Q: Translate the given amino acid sequence into one-letter code.…

A: Genetic codons are long enough to be taken in account in research purposes. So as for such, some…

Q: Describe the process of translating mRNA into proteins. Be sure to also include the following key…

A: The translation is known as a process in which protein is synthesized through the mRNA (transcribed…

Q: The genetic message to make a  specific amino acid in a protein, is carried by a specific   three…

A: Gene is a segment of DNA (deoxyribonucleic acid)/RNA (ribonucleic acid), which codes for a protein…

Q: Interpret this mRNA strand and determine the proper sequence and shape of this protein:  AUG UCA CGC…

A: Introduction :- When transcription occurs, mRNA is produced. RNA polymerase decodes a single strand…

Q: All of the following participate in the process of translation except:     ribosomes mRNA tRNA 35S…

A: Translation  It is defined as the process of production of proteins from the mRNA transcript. In…

Q: What molecules are largely responsible for the universal feature of the genetic code?…

A: DNA is the store house of genetic information. This genetic information is expressed in the form of…

Q: Why may tRNA be considered the “interpreter” of the genetic code?

A: Introduction: RNA is a type of nucleic acid that is a genetic material in some viruses. There are…

Q: A mutation called base substitution mutation had been altered the sequence in a. eliminated the…

A: Base substitution is a type of mutation in which one nucleotide base is substituted by the other and…

Q: List a few exceptions to the genetic code.

A: A gene is a unit of genetic material present on the strand of DNA (Deoxyribonucleic acid). DNA…

Q: How many amino acids does the mRNA strand above code for?

A: 1. 4 amino acids does the above mRNA strand code have -

Q: An mRNA has the following base sequence:5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′Identify the start…

A: Hereditary qualities are a piece of science stressed over the examination of qualities, hereditary…

Q: Briefly describe (two or three sentences) the role of tRNA in building a protein from mRNA.

A: Answer

Q: Sequence: AAA UGG CAA   Is the sequence RNA or DNA? How do you know?   Question 1 options:   You…

A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Q: A particular triplet of bases in the template strand of DNA is 5' AGT 3: The corresponding codon for…

A: Transcription is a heterocatalytic action of DNA by means of which RNA is synthesized from specific…

Q: Why is DNA and not any other macromolecule represents the genetic code?

A: Biomolecules are organic compounds found in living organisms. All living organism will have these…

Q: Translation of mRNA Using the codon chart provided, translate the following messenger RNA sequence…

A:

Q: If the mRNA molecule from your answer to the previous question is going to be translated into a…

A: The gene is the portion of DNA that codes for a specific protein. First, the DNA is converted to…

Q: Briefly describe the events in translation.

A: The translation is one of the defined processes of the cell cycle. It is the last step in fact and…

Q: From the following DNA strand: AAGCTAGGATTGCC How many codons would be present?

A: A codon is made up of three nucleotides. Such codons are abundant in messenger RNA and consist of a…

Q: What is the mRNA strand of the following DNA (coding) strand: ATGGCTAACCTTGTA

A: Gene expression is the process through which data from a gene is employed in the synthesis of a…

Q: State the direction of movement of the ribosome along the mRNA strand (the direction of…

A: Protein synthesis involves translation of mRNA into protein that requires three complex stages:…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.